ID: 1179150379

View in Genome Browser
Species Human (GRCh38)
Location 21:38804645-38804667
Sequence TCGGGGACCCAGAAACATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179150369_1179150379 26 Left 1179150369 21:38804596-38804618 CCGTATAGATTCTGACTGTGACT No data
Right 1179150379 21:38804645-38804667 TCGGGGACCCAGAAACATTAAGG No data
1179150372_1179150379 -1 Left 1179150372 21:38804623-38804645 CCACGGTGATACCCGGAGACCTT No data
Right 1179150379 21:38804645-38804667 TCGGGGACCCAGAAACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179150379 Original CRISPR TCGGGGACCCAGAAACATTA AGG Intergenic
No off target data available for this crispr