ID: 1179150859

View in Genome Browser
Species Human (GRCh38)
Location 21:38806637-38806659
Sequence CCGCGCCCCGCAGGTTCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179150859_1179150874 22 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150874 21:38806682-38806704 CGCGTCCAGGGCCCGGGCTGGGG 0: 1
1: 0
2: 2
3: 27
4: 320
1179150859_1179150867 10 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150867 21:38806670-38806692 TCACCTGCTCGCCGCGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1179150859_1179150866 9 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150866 21:38806669-38806691 GTCACCTGCTCGCCGCGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 51
1179150859_1179150869 15 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150869 21:38806675-38806697 TGCTCGCCGCGTCCAGGGCCCGG 0: 1
1: 0
2: 1
3: 9
4: 112
1179150859_1179150870 16 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150870 21:38806676-38806698 GCTCGCCGCGTCCAGGGCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 166
1179150859_1179150873 21 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150873 21:38806681-38806703 CCGCGTCCAGGGCCCGGGCTGGG 0: 1
1: 0
2: 2
3: 28
4: 250
1179150859_1179150871 20 Left 1179150859 21:38806637-38806659 CCGCGGGAACCTGCGGGGCGCGG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1179150871 21:38806680-38806702 GCCGCGTCCAGGGCCCGGGCTGG 0: 1
1: 0
2: 3
3: 33
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179150859 Original CRISPR CCGCGCCCCGCAGGTTCCCG CGG (reversed) Intronic
900227394 1:1539712-1539734 CCTCGCCCCGCAGGTGCGGGAGG + Exonic
901083134 1:6594736-6594758 CCACGCCCAGCTGGTTCCTGAGG - Intronic
902370901 1:16006217-16006239 CTGCCCCCAGGAGGTTCCCGAGG + Exonic
910200137 1:84690523-84690545 CCGGCCTCCGCAGGTTTCCGAGG + Exonic
922756972 1:228102214-228102236 CCACGCCCCGCAGCGCCCCGGGG + Intronic
1073577465 10:104638809-104638831 CCAGTCCCCGCAGCTTCCCGCGG - Intergenic
1074121675 10:110498066-110498088 GCGCGCCCCGCGGGTGCCCACGG - Exonic
1074586013 10:114768257-114768279 CCGCGCCCGGCGGGTCCCTGCGG - Intergenic
1076371675 10:129959580-129959602 TGGCGCCCCGCGGCTTCCCGCGG + Intronic
1076554463 10:131312339-131312361 CCGCGCCCCACAGTGGCCCGCGG + Intergenic
1077081262 11:725715-725737 GCGCGCCCCGCAGGTGCTGGAGG + Exonic
1077214281 11:1388952-1388974 CCGCGCCGCGCAGGTCACTGTGG + Intergenic
1083997166 11:66278294-66278316 CCGCGCCCCCCACGGCCCCGCGG + Exonic
1084758291 11:71252494-71252516 CGGCGCCGCTCGGGTTCCCGCGG - Intronic
1085037706 11:73309782-73309804 GCCAGCCCCGCAGGCTCCCGCGG + Exonic
1085458813 11:76680926-76680948 CCCCAGCCCGCAGGCTCCCGGGG - Intergenic
1088893139 11:114059924-114059946 CCGCGCGCCGGGGCTTCCCGGGG + Intronic
1095949351 12:47773444-47773466 CCGCGCCGCCCAGCGTCCCGGGG - Intronic
1096021569 12:48329737-48329759 CCGCGCCCCGGAGCTCCCGGAGG + Exonic
1097891492 12:64781294-64781316 CCGGGCGCAGCAGGGTCCCGGGG + Intronic
1103562573 12:121800217-121800239 CCGCGCCTCGGGGGATCCCGGGG + Intronic
1103562779 12:121800819-121800841 CTGCGCCCCGCGGGCTCTCGGGG + Intronic
1104989665 12:132618642-132618664 CCCCGCCCCGCAGGTGTCCCGGG - Intergenic
1107604173 13:42041327-42041349 CCTGGGCGCGCAGGTTCCCGGGG + Intronic
1108478466 13:50843517-50843539 CTGGGTCCCGCGGGTTCCCGGGG + Exonic
1113739645 13:112702414-112702436 CCGCCCCCCGCGTGTTCCAGTGG + Intronic
1114454835 14:22847664-22847686 CCCCGCCCTGCAGGTTCCTGGGG - Exonic
1118312494 14:64704284-64704306 CCGCGCCGCGAAGGTTGCCCCGG + Intronic
1118971473 14:70641841-70641863 CCGCCACCCGCAGGTTGCGGAGG + Exonic
1121595365 14:95157758-95157780 CCTCGGCGCGCGGGTTCCCGGGG - Intronic
1122065830 14:99174037-99174059 CCGCACCCCGCGTGTCCCCGGGG - Exonic
1122550097 14:102544907-102544929 CCACACCCCGCAGGTTCAGGAGG + Intergenic
1122720366 14:103718500-103718522 CCCTGCCCCACAGGTTCCTGAGG - Intronic
1125464112 15:39934124-39934146 CCCCGCCCCGCAGGCTGCCGGGG + Intronic
1129322380 15:74782319-74782341 CCACGCCCCGCGGGCTCCGGCGG - Exonic
1132610914 16:816006-816028 GCCCTCCCCGCAGGGTCCCGTGG + Intergenic
1135190284 16:20348827-20348849 CCCCGGCCCGCAGGAGCCCGGGG + Exonic
1136540059 16:30923954-30923976 CCGCCCACCGCCGGTTCCCGGGG - Intronic
1138348644 16:56334957-56334979 CCCCAGCCCGCAGGTTCCCTGGG - Intronic
1142222693 16:88863491-88863513 CAGAGCCCCGCAGATCCCCGTGG + Exonic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1147110382 17:38257187-38257209 CCCCGCCCCCCAGGCTCCCCCGG - Intergenic
1147341267 17:39754457-39754479 CCGCGCGCTGCAGATGCCCGCGG + Intergenic
1148356578 17:46979317-46979339 CCCCGCCCCGCCGGTCCCCGCGG + Intronic
1148419128 17:47531244-47531266 CCCCGCCCCCCAGGCTCCCCCGG + Exonic
1148680326 17:49470075-49470097 CTGCCCACCGCAGCTTCCCGGGG + Intronic
1149651520 17:58279205-58279227 CCGTGTCCCGCAGGCTCGCGCGG - Exonic
1151618911 17:75233045-75233067 CCGGGCCCTGCAGGTTCCTCAGG + Exonic
1152356491 17:79810106-79810128 CCCCTCCCCGCCGGCTCCCGGGG + Intergenic
1152729010 17:81960912-81960934 CCGCTCCCCGCAGGTGGACGCGG - Exonic
1154133012 18:11752023-11752045 CCCCGCCCAGCGGGTCCCCGAGG - Intronic
1155972274 18:32093027-32093049 CCCCGCCCCTCAGAGTCCCGGGG + Intronic
1160452132 18:78973448-78973470 CAGCCCCTCGCAGGTCCCCGCGG - Intergenic
1161628806 19:5341012-5341034 CCGCGCCCCACGTGCTCCCGCGG - Intergenic
1161923209 19:7282072-7282094 CCGTGCCCCGCCGGCTCGCGGGG - Intronic
1162070358 19:8149135-8149157 TCGCGCCCCGCGGGCTCCGGGGG - Intronic
1166358766 19:42242940-42242962 CCGAGACCCGCAGGTTCACGCGG - Intronic
1166798047 19:45439883-45439905 CGGCGCCGCGCGGGTTCCCGAGG - Intronic
1167074396 19:47239935-47239957 GCGCGCCCGGCAGCTCCCCGGGG - Intergenic
1167483358 19:49746309-49746331 CCGCCCACCTCAGGTCCCCGAGG + Intronic
1167732817 19:51271252-51271274 CCCCGCCCCGCAAGCTCGCGCGG - Intergenic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
937950908 2:127387573-127387595 GCGCGCCCCTCCGGTCCCCGGGG - Intronic
938583864 2:132670472-132670494 CCGCACCCGGCAGGTCCCCACGG - Intronic
941164851 2:162073946-162073968 CCGCGCCACGTACGTCCCCGGGG - Intronic
943342077 2:186693913-186693935 CCGCGCCCCGCAGCCACCTGGGG - Intergenic
946966421 2:225042201-225042223 CCGCGCGCCCCAGGCGCCCGGGG - Intronic
1169129470 20:3158003-3158025 CCTCGCCCGGGAGGTTGCCGGGG - Intronic
1169863126 20:10172526-10172548 CAGCGCCCCGAGGGCTCCCGCGG - Intergenic
1171446319 20:25207123-25207145 TCGCCACCCGCAGGCTCCCGTGG - Exonic
1171532267 20:25860565-25860587 CAGTGCCTCGCATGTTCCCGTGG - Intronic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1173865140 20:46308292-46308314 CCGCCCCACGCAGCGTCCCGAGG - Exonic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1176177330 20:63734953-63734975 CCGTGCTCCTCAGATTCCCGGGG + Intronic
1176177354 20:63735049-63735071 CCGTGCTCCTCAGATTCCCGGGG + Intronic
1176177368 20:63735097-63735119 CCGTGCTCCTCAGATTCCCGGGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179994275 21:44966873-44966895 GCCCGCCCTGCAGGTTCCCAGGG + Intronic
1181009675 22:20032985-20033007 CCAAGCCCTGCAGGTTCCCTAGG - Intronic
1181543033 22:23584087-23584109 CCCAGCCCCGCAGGGTCCCCAGG - Intergenic
1182237033 22:28883906-28883928 CCGCGCCGCGCCGGGCCCCGCGG - Exonic
1183486384 22:38089460-38089482 CCGCCCCCCGCGGGGGCCCGGGG - Intronic
1183494501 22:38134928-38134950 CCGGGCCCCGCAGGTCCTCAGGG - Intronic
1183537737 22:38412991-38413013 CCGGGGCCCGCAGGGGCCCGCGG + Intergenic
1183665209 22:39242780-39242802 CCGCACCTCGCCGGCTCCCGGGG - Intronic
1184100808 22:42340993-42341015 GCGCGCCCCGCAGCTCCGCGGGG - Intronic
1184345014 22:43907840-43907862 ACTGGCCCCGCAGGTTCCCCTGG - Intergenic
949105860 3:198359-198381 CCGCGCACGGCGCGTTCCCGCGG - Intronic
950036654 3:9890849-9890871 CCAAGCCCCGCAGGCTCCAGCGG - Intronic
950584167 3:13880710-13880732 CTGCGCCCCTCACGCTCCCGCGG - Intergenic
953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG + Intronic
954668912 3:52277703-52277725 CCCTGCCCCTCAGCTTCCCGCGG - Intronic
954912776 3:54122646-54122668 CCGCTCCGCGCAGCTCCCCGCGG + Exonic
961012933 3:123448179-123448201 CCGCGCCCCGCCGCTGCCGGCGG + Exonic
961742940 3:129045705-129045727 CGACCCCCCGCAGGTCCCCGCGG + Intergenic
971482582 4:27127600-27127622 CCCTGGCCCACAGGTTCCCGGGG - Intergenic
978621281 4:110636807-110636829 CCGCGTCCCACTGCTTCCCGGGG + Intronic
980035816 4:127881381-127881403 CCCCGCCCGGCAGTGTCCCGAGG + Intronic
982357945 4:154490329-154490351 CCGCGCCCGGCAAGTGCCTGGGG - Intronic
994359983 5:98839643-98839665 CCGCGCGCCGCTGGCTCCGGGGG - Intergenic
998332765 5:141344199-141344221 CCGCGCTCCGCCAGCTCCCGGGG - Exonic
998334066 5:141355366-141355388 CCGCGCTCCGCCAGCTCCCGGGG - Exonic
998337107 5:141383065-141383087 CCGCGCTCCGCCAGCTCCCGGGG - Exonic
998340480 5:141413353-141413375 CCGCGCTCCGCCAGCTCCCGGGG - Exonic
998342516 5:141430925-141430947 CCGCGCTCCGCGAGCTCCCGGGG - Exonic
999748810 5:154611034-154611056 ACGCGCCCAGCAAGTTCCTGGGG + Intergenic
1000209117 5:159095224-159095246 CCTCGCCCCTCTGCTTCCCGGGG + Intronic
1002296259 5:178232840-178232862 CCCCGCCCCGCAGGCCCCTGCGG + Intergenic
1003990277 6:11479999-11480021 CCTCTCCCCACAGGTTCCCACGG - Intergenic
1006078181 6:31547703-31547725 CCCCTCCCCCCAGGTTCCAGAGG + Exonic
1008932506 6:56955052-56955074 CCGCCCCCCGCAGGCTGCCGCGG - Intergenic
1014272531 6:119349841-119349863 ACGCGCCGCCCAGGGTCCCGCGG + Intergenic
1018653284 6:166008681-166008703 CGGCGCCCCGCAGGCTTCCCGGG - Intergenic
1018709618 6:166488787-166488809 CAGCGCCCTGCACGTTCCCGTGG + Intronic
1019180080 6:170181234-170181256 GAGCACCCCACAGGTTCCCGTGG + Intergenic
1019743861 7:2688708-2688730 CGGCGCCCTGGAGGTTCCCCGGG - Intronic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1026523060 7:71132742-71132764 CCGCGCCTCGCCGGAGCCCGAGG + Exonic
1028198496 7:87934368-87934390 CCGCGCCCCCGGGGTCCCCGCGG - Exonic
1029359974 7:100081536-100081558 CTGCGGCCCGCAGGGTCCCCCGG - Intronic
1032092111 7:128916144-128916166 CCGCGCCCCTCAGGCACCTGCGG - Intergenic
1032095825 7:128938158-128938180 CCGCGCCCCCCAGGCACCTGCGG + Intronic
1032095830 7:128938165-128938187 CCGCCGCCCGCAGGTGCCTGGGG - Intronic
1033165399 7:139035376-139035398 CCGCGTCGCGCAGGATCCGGGGG + Intronic
1033661976 7:143408670-143408692 CCGCGCCCCGCCCCTTCCCGGGG - Intronic
1035127170 7:156616843-156616865 CCGCGCCCCGCTCCTGCCCGCGG + Intergenic
1035579634 8:731710-731732 CCGTGTCTCGCAGGTGCCCGGGG - Intronic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1038404570 8:27311625-27311647 CCGCGGGCCTGAGGTTCCCGGGG - Exonic
1049482859 8:142835086-142835108 CCACTCCCCGCAGGTTCCTGGGG + Intronic
1049615137 8:143572666-143572688 CCGGGCCCGGGAGGCTCCCGTGG - Exonic
1051483135 9:17579797-17579819 CCGCCGCCCGCAGGCTCCAGGGG + Intronic
1051659180 9:19409634-19409656 ACGCCCCCCGCAGGTCCCCGCGG + Intronic
1051867348 9:21696596-21696618 CGGCCCCGCGCAGGTCCCCGGGG + Intergenic
1053500117 9:38581034-38581056 CTGCTCCCCTCAGGTTCCCTAGG - Intergenic
1053835340 9:42129321-42129343 GCGCGGCCCCCAGGCTCCCGCGG - Exonic
1057733789 9:97634011-97634033 CGGCTCCCCGCACGTTCCCGGGG - Intronic
1058005137 9:99906575-99906597 CCCCGCCCCGCAGGGCCCCCAGG - Intergenic
1061153974 9:128846037-128846059 CCGCTCCTCGGAGGGTCCCGGGG + Intronic
1061348100 9:130042911-130042933 GCGCGCCCCGCATCTGCCCGCGG + Intronic
1186349978 X:8731367-8731389 CCCAGCCCCGCAGGTGCCCGCGG - Intronic
1189331010 X:40145277-40145299 CCGGGCGCCGCGGGTTCGCGCGG - Intronic