ID: 1179153218

View in Genome Browser
Species Human (GRCh38)
Location 21:38827357-38827379
Sequence AGGTTAAGACTATTTTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179153218_1179153223 3 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153223 21:38827383-38827405 GGATCCTTCTGAAAGGGTCTCGG No data
1179153218_1179153225 21 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153225 21:38827401-38827423 CTCGGAGACCTCAGAGTCTGTGG No data
1179153218_1179153227 23 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153227 21:38827403-38827425 CGGAGACCTCAGAGTCTGTGGGG No data
1179153218_1179153222 -3 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153222 21:38827377-38827399 CCTTGAGGATCCTTCTGAAAGGG No data
1179153218_1179153220 -4 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153220 21:38827376-38827398 ACCTTGAGGATCCTTCTGAAAGG No data
1179153218_1179153226 22 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153226 21:38827402-38827424 TCGGAGACCTCAGAGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179153218 Original CRISPR AGGTTAAGACTATTTTTACA AGG (reversed) Intergenic