ID: 1179153223

View in Genome Browser
Species Human (GRCh38)
Location 21:38827383-38827405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179153218_1179153223 3 Left 1179153218 21:38827357-38827379 CCTTGTAAAAATAGTCTTAACCT No data
Right 1179153223 21:38827383-38827405 GGATCCTTCTGAAAGGGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179153223 Original CRISPR GGATCCTTCTGAAAGGGTCT CGG Intergenic