ID: 1179154483

View in Genome Browser
Species Human (GRCh38)
Location 21:38838257-38838279
Sequence CTGCAGAGACAGTTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179154483_1179154492 -5 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154492 21:38838275-38838297 TGCAGCCGGCTGGGGAGGGTGGG No data
1179154483_1179154494 5 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154494 21:38838285-38838307 TGGGGAGGGTGGGAACATCAAGG No data
1179154483_1179154489 -10 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG No data
1179154483_1179154491 -6 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154491 21:38838274-38838296 CTGCAGCCGGCTGGGGAGGGTGG No data
1179154483_1179154499 26 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154499 21:38838306-38838328 GGAAGGCTCTCTGGAGGAGGTGG No data
1179154483_1179154496 17 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154496 21:38838297-38838319 GAACATCAAGGAAGGCTCTCTGG No data
1179154483_1179154498 23 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154498 21:38838303-38838325 CAAGGAAGGCTCTCTGGAGGAGG No data
1179154483_1179154490 -9 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154490 21:38838271-38838293 TCTCTGCAGCCGGCTGGGGAGGG No data
1179154483_1179154495 9 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154495 21:38838289-38838311 GAGGGTGGGAACATCAAGGAAGG No data
1179154483_1179154497 20 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154497 21:38838300-38838322 CATCAAGGAAGGCTCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179154483 Original CRISPR CTGCAGAGACAGTTGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr