ID: 1179154489

View in Genome Browser
Species Human (GRCh38)
Location 21:38838270-38838292
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179154481_1179154489 -8 Left 1179154481 21:38838255-38838277 CCCCATGCTCCAACTGTCTCTGC No data
Right 1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG No data
1179154478_1179154489 29 Left 1179154478 21:38838218-38838240 CCTACTAAGGTGGCCACGGCGCA No data
Right 1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG No data
1179154483_1179154489 -10 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG No data
1179154482_1179154489 -9 Left 1179154482 21:38838256-38838278 CCCATGCTCCAACTGTCTCTGCA No data
Right 1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG No data
1179154480_1179154489 16 Left 1179154480 21:38838231-38838253 CCACGGCGCATTGCTGGAGCTGT No data
Right 1179154489 21:38838270-38838292 GTCTCTGCAGCCGGCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179154489 Original CRISPR GTCTCTGCAGCCGGCTGGGG AGG Intergenic
No off target data available for this crispr