ID: 1179154497

View in Genome Browser
Species Human (GRCh38)
Location 21:38838300-38838322
Sequence CATCAAGGAAGGCTCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179154481_1179154497 22 Left 1179154481 21:38838255-38838277 CCCCATGCTCCAACTGTCTCTGC No data
Right 1179154497 21:38838300-38838322 CATCAAGGAAGGCTCTCTGGAGG No data
1179154485_1179154497 13 Left 1179154485 21:38838264-38838286 CCAACTGTCTCTGCAGCCGGCTG No data
Right 1179154497 21:38838300-38838322 CATCAAGGAAGGCTCTCTGGAGG No data
1179154482_1179154497 21 Left 1179154482 21:38838256-38838278 CCCATGCTCCAACTGTCTCTGCA No data
Right 1179154497 21:38838300-38838322 CATCAAGGAAGGCTCTCTGGAGG No data
1179154483_1179154497 20 Left 1179154483 21:38838257-38838279 CCATGCTCCAACTGTCTCTGCAG No data
Right 1179154497 21:38838300-38838322 CATCAAGGAAGGCTCTCTGGAGG No data
1179154493_1179154497 -3 Left 1179154493 21:38838280-38838302 CCGGCTGGGGAGGGTGGGAACAT No data
Right 1179154497 21:38838300-38838322 CATCAAGGAAGGCTCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179154497 Original CRISPR CATCAAGGAAGGCTCTCTGG AGG Intergenic
No off target data available for this crispr