ID: 1179155528

View in Genome Browser
Species Human (GRCh38)
Location 21:38847764-38847786
Sequence GGGCGACTTCCAGAAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179155528_1179155532 7 Left 1179155528 21:38847764-38847786 CCCTGAGCTTCTGGAAGTCGCCC No data
Right 1179155532 21:38847794-38847816 CACTACGTTATTTGCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179155528 Original CRISPR GGGCGACTTCCAGAAGCTCA GGG (reversed) Intergenic
No off target data available for this crispr