ID: 1179155767

View in Genome Browser
Species Human (GRCh38)
Location 21:38849773-38849795
Sequence TTCACTGTGAAGACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179155765_1179155767 1 Left 1179155765 21:38849749-38849771 CCGTGGAAGCAGAGGTTGGAACA No data
Right 1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179155767 Original CRISPR TTCACTGTGAAGACAGAGGA AGG Intergenic
No off target data available for this crispr