ID: 1179156464

View in Genome Browser
Species Human (GRCh38)
Location 21:38855975-38855997
Sequence CAAAATGCTGATAATAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156461_1179156464 5 Left 1179156461 21:38855947-38855969 CCATTTTAGCAAACGTACTGCAA No data
Right 1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG No data
1179156460_1179156464 18 Left 1179156460 21:38855934-38855956 CCAGTACTTTCATCCATTTTAGC No data
Right 1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156464 Original CRISPR CAAAATGCTGATAATAATAG GGG Intergenic
No off target data available for this crispr