ID: 1179156709

View in Genome Browser
Species Human (GRCh38)
Location 21:38857442-38857464
Sequence AACCAGGACAGATAATCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156709_1179156714 18 Left 1179156709 21:38857442-38857464 CCAACTGATTATCTGTCCTGGTT No data
Right 1179156714 21:38857483-38857505 TTAGATACAGAACACTCCGCAGG No data
1179156709_1179156716 30 Left 1179156709 21:38857442-38857464 CCAACTGATTATCTGTCCTGGTT No data
Right 1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG No data
1179156709_1179156715 19 Left 1179156709 21:38857442-38857464 CCAACTGATTATCTGTCCTGGTT No data
Right 1179156715 21:38857484-38857506 TAGATACAGAACACTCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156709 Original CRISPR AACCAGGACAGATAATCAGT TGG (reversed) Intergenic
No off target data available for this crispr