ID: 1179156711

View in Genome Browser
Species Human (GRCh38)
Location 21:38857458-38857480
Sequence CAAACAGGTGCCTGGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156711_1179156714 2 Left 1179156711 21:38857458-38857480 CCTGGTTGCCAGGCACCTGTTTG No data
Right 1179156714 21:38857483-38857505 TTAGATACAGAACACTCCGCAGG No data
1179156711_1179156718 23 Left 1179156711 21:38857458-38857480 CCTGGTTGCCAGGCACCTGTTTG No data
Right 1179156718 21:38857504-38857526 GGGTCCCGAGTAGGCAGTTGTGG No data
1179156711_1179156715 3 Left 1179156711 21:38857458-38857480 CCTGGTTGCCAGGCACCTGTTTG No data
Right 1179156715 21:38857484-38857506 TAGATACAGAACACTCCGCAGGG No data
1179156711_1179156716 14 Left 1179156711 21:38857458-38857480 CCTGGTTGCCAGGCACCTGTTTG No data
Right 1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156711 Original CRISPR CAAACAGGTGCCTGGCAACC AGG (reversed) Intergenic
No off target data available for this crispr