ID: 1179156712

View in Genome Browser
Species Human (GRCh38)
Location 21:38857466-38857488
Sequence ATCTAATGCAAACAGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156712_1179156721 23 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156721 21:38857512-38857534 AGTAGGCAGTTGTGGTCCACAGG No data
1179156712_1179156722 30 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156722 21:38857519-38857541 AGTTGTGGTCCACAGGCCACTGG No data
1179156712_1179156714 -6 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156714 21:38857483-38857505 TTAGATACAGAACACTCCGCAGG No data
1179156712_1179156716 6 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG No data
1179156712_1179156715 -5 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156715 21:38857484-38857506 TAGATACAGAACACTCCGCAGGG No data
1179156712_1179156718 15 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156718 21:38857504-38857526 GGGTCCCGAGTAGGCAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156712 Original CRISPR ATCTAATGCAAACAGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr