ID: 1179156713

View in Genome Browser
Species Human (GRCh38)
Location 21:38857473-38857495
Sequence GTTCTGTATCTAATGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156713_1179156718 8 Left 1179156713 21:38857473-38857495 CCTGTTTGCATTAGATACAGAAC No data
Right 1179156718 21:38857504-38857526 GGGTCCCGAGTAGGCAGTTGTGG No data
1179156713_1179156721 16 Left 1179156713 21:38857473-38857495 CCTGTTTGCATTAGATACAGAAC No data
Right 1179156721 21:38857512-38857534 AGTAGGCAGTTGTGGTCCACAGG No data
1179156713_1179156716 -1 Left 1179156713 21:38857473-38857495 CCTGTTTGCATTAGATACAGAAC No data
Right 1179156716 21:38857495-38857517 CACTCCGCAGGGTCCCGAGTAGG No data
1179156713_1179156722 23 Left 1179156713 21:38857473-38857495 CCTGTTTGCATTAGATACAGAAC No data
Right 1179156722 21:38857519-38857541 AGTTGTGGTCCACAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156713 Original CRISPR GTTCTGTATCTAATGCAAAC AGG (reversed) Intergenic
No off target data available for this crispr