ID: 1179156718

View in Genome Browser
Species Human (GRCh38)
Location 21:38857504-38857526
Sequence GGGTCCCGAGTAGGCAGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156712_1179156718 15 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156718 21:38857504-38857526 GGGTCCCGAGTAGGCAGTTGTGG No data
1179156713_1179156718 8 Left 1179156713 21:38857473-38857495 CCTGTTTGCATTAGATACAGAAC No data
Right 1179156718 21:38857504-38857526 GGGTCCCGAGTAGGCAGTTGTGG No data
1179156711_1179156718 23 Left 1179156711 21:38857458-38857480 CCTGGTTGCCAGGCACCTGTTTG No data
Right 1179156718 21:38857504-38857526 GGGTCCCGAGTAGGCAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156718 Original CRISPR GGGTCCCGAGTAGGCAGTTG TGG Intergenic
No off target data available for this crispr