ID: 1179156722

View in Genome Browser
Species Human (GRCh38)
Location 21:38857519-38857541
Sequence AGTTGTGGTCCACAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179156717_1179156722 -3 Left 1179156717 21:38857499-38857521 CCGCAGGGTCCCGAGTAGGCAGT No data
Right 1179156722 21:38857519-38857541 AGTTGTGGTCCACAGGCCACTGG No data
1179156712_1179156722 30 Left 1179156712 21:38857466-38857488 CCAGGCACCTGTTTGCATTAGAT No data
Right 1179156722 21:38857519-38857541 AGTTGTGGTCCACAGGCCACTGG No data
1179156713_1179156722 23 Left 1179156713 21:38857473-38857495 CCTGTTTGCATTAGATACAGAAC No data
Right 1179156722 21:38857519-38857541 AGTTGTGGTCCACAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179156722 Original CRISPR AGTTGTGGTCCACAGGCCAC TGG Intergenic
No off target data available for this crispr