ID: 1179158864

View in Genome Browser
Species Human (GRCh38)
Location 21:38875438-38875460
Sequence ATCAGCCCACTTTTTGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179158864_1179158866 -8 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158866 21:38875453-38875475 GGGCTGATGGAAATGAGCATTGG No data
1179158864_1179158870 12 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158870 21:38875473-38875495 TGGGTGCATGGTGCTTGGACTGG No data
1179158864_1179158869 7 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158869 21:38875468-38875490 AGCATTGGGTGCATGGTGCTTGG No data
1179158864_1179158867 -7 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158867 21:38875454-38875476 GGCTGATGGAAATGAGCATTGGG No data
1179158864_1179158871 13 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158871 21:38875474-38875496 GGGTGCATGGTGCTTGGACTGGG No data
1179158864_1179158868 0 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158868 21:38875461-38875483 GGAAATGAGCATTGGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179158864 Original CRISPR ATCAGCCCACTTTTTGCCAG TGG (reversed) Intergenic