ID: 1179158870

View in Genome Browser
Species Human (GRCh38)
Location 21:38875473-38875495
Sequence TGGGTGCATGGTGCTTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179158864_1179158870 12 Left 1179158864 21:38875438-38875460 CCACTGGCAAAAAGTGGGCTGAT No data
Right 1179158870 21:38875473-38875495 TGGGTGCATGGTGCTTGGACTGG No data
1179158863_1179158870 13 Left 1179158863 21:38875437-38875459 CCCACTGGCAAAAAGTGGGCTGA No data
Right 1179158870 21:38875473-38875495 TGGGTGCATGGTGCTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179158870 Original CRISPR TGGGTGCATGGTGCTTGGAC TGG Intergenic