ID: 1179158870 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:38875473-38875495 |
Sequence | TGGGTGCATGGTGCTTGGAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179158864_1179158870 | 12 | Left | 1179158864 | 21:38875438-38875460 | CCACTGGCAAAAAGTGGGCTGAT | No data | ||
Right | 1179158870 | 21:38875473-38875495 | TGGGTGCATGGTGCTTGGACTGG | No data | ||||
1179158863_1179158870 | 13 | Left | 1179158863 | 21:38875437-38875459 | CCCACTGGCAAAAAGTGGGCTGA | No data | ||
Right | 1179158870 | 21:38875473-38875495 | TGGGTGCATGGTGCTTGGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179158870 | Original CRISPR | TGGGTGCATGGTGCTTGGAC TGG | Intergenic | ||