ID: 1179158974

View in Genome Browser
Species Human (GRCh38)
Location 21:38876334-38876356
Sequence CTTTGAACACACCTGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179158974 Original CRISPR CTTTGAACACACCTGCAACA AGG (reversed) Intergenic
901788484 1:11640411-11640433 TTTTGAACACACCTATCACATGG + Intergenic
902573850 1:17364268-17364290 CTTTAAACTCACCTACAACTGGG + Intergenic
903534330 1:24056667-24056689 CTTTGAAAACACCTTCATCCAGG - Exonic
903823575 1:26124145-26124167 CTCTGAACACATTTGAAACAGGG - Exonic
904370662 1:30045634-30045656 CTCCCAACACACCTGCATCAAGG + Intergenic
904767129 1:32858819-32858841 CATTAAACACAACTGCTACAAGG - Exonic
907074924 1:51569401-51569423 CTTTGAAGAGTCCTGCCACATGG + Intergenic
908256225 1:62305699-62305721 CTCTGAACCCTCCTGCAACACGG + Intronic
909347541 1:74609640-74609662 CTTTTACCTGACCTGCAACAGGG + Intronic
909688198 1:78374816-78374838 ATTTGATCTCACCTGAAACAAGG - Intronic
910229633 1:84972993-84973015 CTTTGGAGACAACTGCAGCAGGG - Intronic
910453127 1:87367392-87367414 CTCTGAACACATCTGTAAAATGG + Intergenic
912011597 1:104971051-104971073 TATTGAGCACACCTGCAATACGG - Intergenic
913133148 1:115861505-115861527 ATTTGACCACACCAGCAGCATGG + Intergenic
913472977 1:119208540-119208562 CTTTGAAAATACCTGCTCCATGG + Intergenic
913530401 1:119729948-119729970 CTTTGTAAACCCCTGAAACATGG + Intronic
915784037 1:158587678-158587700 CTTCTAACACTGCTGCAACAGGG - Intergenic
916724896 1:167514624-167514646 CTTTGAACAAACATTCAATATGG - Intronic
919214221 1:194531545-194531567 CTCTGAACAGACCAGTAACAAGG - Intergenic
920794613 1:209126888-209126910 CTCTGAACACACAGGCACCAAGG + Intergenic
1064619736 10:17202607-17202629 CTTTGAATCCACCTGTAACCTGG - Intergenic
1065755768 10:28929077-28929099 CTTTGAAGAAACCTAGAACATGG + Intergenic
1065953578 10:30674009-30674031 CTGTGAAAACACGTGCAACATGG + Intergenic
1067143286 10:43674078-43674100 CCTTGAAAACATCTGCATCAAGG - Intergenic
1069560881 10:69428454-69428476 GTTTGCACACACATGCATCAGGG - Intergenic
1069959595 10:72072097-72072119 CTTTGAACACACCCCCTCCAGGG + Intronic
1071534531 10:86416960-86416982 GTTTAAAGACACCTGGAACAGGG - Intergenic
1073100553 10:101004156-101004178 CTCTGACCACACCTGGCACATGG - Exonic
1076411092 10:130251416-130251438 CTGTGAATAAACCTGAAACAAGG - Intergenic
1083383387 11:62287716-62287738 CTTTGAGCTCACTTTCAACAAGG - Intergenic
1085913289 11:80854044-80854066 CTTTGAACACATATGACACAAGG + Intergenic
1086816048 11:91372302-91372324 CTTTCAACTCACCTGTAATAAGG + Intergenic
1087371864 11:97294195-97294217 CTTATAACCCACATGCAACAGGG - Intergenic
1087813817 11:102636585-102636607 ATTAGAACTCACCTGCAAGAAGG + Intergenic
1097890176 12:64770184-64770206 TTTTGAAAACTTCTGCAACATGG - Intergenic
1097935141 12:65240228-65240250 CTTTGAACACACCTGTCATGAGG - Exonic
1103572940 12:121856988-121857010 CTTTGTACAGCCATGCAACACGG - Intronic
1111574223 13:90129839-90129861 GTTTGAACACAGCTGCAATTGGG + Intergenic
1111611127 13:90608987-90609009 ATTAGAAAACACCTGCAAAAAGG + Intergenic
1116842065 14:49829094-49829116 CTTTGATTGCACTTGCAACAGGG + Exonic
1117355374 14:54918964-54918986 CCTTAAACATATCTGCAACATGG + Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG + Intronic
1121210363 14:92203898-92203920 CTTAGGACCCACCTCCAACATGG - Intergenic
1122596222 14:102894522-102894544 CTTGGAACACACCTGCCAGGTGG + Intronic
1125924516 15:43551565-43551587 GTCTAAACACACCTGTAACAAGG - Intronic
1127719287 15:61683949-61683971 CTCTTAACTCACCTGCAAAATGG - Intergenic
1128215822 15:65933430-65933452 CCATCAACAGACCTGCAACAGGG - Intronic
1129526097 15:76215587-76215609 CTTTGAACAGGCCTGCAGGAAGG - Exonic
1130369379 15:83271343-83271365 GTTTGAACACAGCTGCAGCTAGG + Intronic
1131349534 15:91685424-91685446 ATTTGAATAGACCTGTAACAAGG + Intergenic
1136289526 16:29262973-29262995 CTTTGAACCCACCTGTGACCAGG - Intergenic
1136869482 16:33792538-33792560 CTATGACCTCACCTGCAACCTGG + Intergenic
1138535448 16:57657531-57657553 CATTGCACACACCTCCACCAGGG + Intronic
1140197110 16:72864321-72864343 CTTTGAAGATACCTGGCACATGG + Intronic
1141682867 16:85554531-85554553 ATTTGATTACACTTGCAACAGGG + Intergenic
1142095263 16:88235953-88235975 CTTTGAACCCACCTGTGACCAGG - Intergenic
1203102691 16_KI270728v1_random:1323530-1323552 CTATGACCTCACCTGCAACCTGG - Intergenic
1144246448 17:13370761-13370783 ATTGGAACGCACCTGAAACAAGG + Intergenic
1145857498 17:28175491-28175513 CATTCAAAACACGTGCAACATGG - Intronic
1146538662 17:33675463-33675485 CTTTGAAAAAGCCTGCAACCTGG + Intronic
1149349059 17:55769012-55769034 CTTTGAGGACAGCTGCAACAGGG + Intronic
1153424381 18:4945920-4945942 CTTTATCCACACCTGCAGCAAGG + Intergenic
1155534443 18:26802546-26802568 ATTTGTACACATCTTCAACATGG - Intergenic
1157282636 18:46356224-46356246 CCTAGAACACACCTGGAACAGGG - Intronic
1158555668 18:58472706-58472728 CTTGGAACACTCCTGCCTCAGGG - Intergenic
1162813828 19:13181247-13181269 CTTTGAACGCACATGCAGGACGG - Intergenic
1162875275 19:13616788-13616810 CCTTGAACACATCAGCCACACGG - Intronic
1163524362 19:17811642-17811664 CTTTGCACACACAGACAACATGG + Exonic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
928334843 2:30388900-30388922 CATTGATCACTCCTGCAAAAGGG - Intergenic
929837766 2:45423203-45423225 CTTGGAACACCCCTACCACAGGG + Intronic
932418488 2:71587767-71587789 CTTTGGCCACAACTTCAACATGG - Intronic
933665233 2:84959474-84959496 CTTGGAACAGACCTGCTCCAGGG + Intergenic
933811475 2:86035425-86035447 CCTTGATCTCATCTGCAACATGG + Intronic
937227855 2:120379867-120379889 ATATGAACACACATGCAACAGGG - Intergenic
940921931 2:159317194-159317216 CTTTAAACACATCCTCAACAAGG - Intergenic
943423547 2:187699424-187699446 CTTTGAACACACATGCTCCATGG - Intergenic
944914779 2:204347323-204347345 CTTTGAACACTCCAGCAGCAAGG - Intergenic
946944008 2:224800953-224800975 CTTTGAATACACCTATAACCTGG - Intronic
946958667 2:224959757-224959779 CCTTGAATACAGCTGCAAAACGG + Intronic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1170226636 20:13997318-13997340 GTTTCAACACACTTTCAACAAGG + Intronic
1170321147 20:15099395-15099417 CTCTCCACACACCTGCAACAAGG + Intronic
1170549076 20:17460315-17460337 CTTGGAAAACCCCTTCAACATGG - Intronic
1170724198 20:18911554-18911576 CTTTGAATCCACCTGCAACCTGG + Intergenic
1171292425 20:23989958-23989980 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1171292627 20:23990885-23990907 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1175682882 20:61004128-61004150 CCTTAAATACACCTGTAACAAGG - Intergenic
1175698279 20:61118796-61118818 CTGCCTACACACCTGCAACAAGG + Intergenic
1178474042 21:32920725-32920747 CTGTGATCAGACCTGCTACATGG + Intergenic
1179158974 21:38876334-38876356 CTTTGAACACACCTGCAACAAGG - Intergenic
1180227902 21:46407801-46407823 CTTTGAAAACACTGACAACATGG - Intronic
1180823494 22:18847719-18847741 CTTTGTCCTCACTTGCAACAGGG + Exonic
1180850589 22:19018115-19018137 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1181123919 22:20690818-20690840 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1181189045 22:21125897-21125919 CTTTGTCCTCACTTGCAACAGGG - Exonic
1181189249 22:21126827-21126849 CTTTGTCCTCACTTGCAACAGGG - Exonic
1181209951 22:21283668-21283690 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1181210155 22:21284598-21284620 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1181399368 22:22642347-22642369 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1181399566 22:22643276-22643298 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1181649853 22:24252792-24252814 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1181650050 22:24253721-24253743 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1181707324 22:24657025-24657047 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1181707522 22:24657954-24657976 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1182244254 22:28943003-28943025 CTTTCAACATACCTGCAAGATGG - Intronic
1182601358 22:31467047-31467069 CAATAAACACATCTGCAACATGG + Intronic
1203216794 22_KI270731v1_random:10835-10857 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1203216995 22_KI270731v1_random:11765-11787 CTTTGTCCTCACTTGCAACAGGG - Intergenic
1203273635 22_KI270734v1_random:73625-73647 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1203273835 22_KI270734v1_random:74555-74577 CTTTGTCCTCACTTGCAACAGGG + Intergenic
949136286 3:570304-570326 ATATGAACACACCTGCATTAAGG - Intergenic
949227749 3:1714029-1714051 CTTTGAACACCTCAGCCACATGG + Intergenic
951621811 3:24609998-24610020 CTTTGAAGGAACCTGCAATAAGG + Intergenic
951662636 3:25086719-25086741 CTTTGAATACACCTGTGACCTGG - Intergenic
961107174 3:124251891-124251913 CATTGCAAACACCTGGAACAGGG - Intronic
971970375 4:33611960-33611982 CTTTGAATCCACCAGCAACCTGG - Intergenic
974484096 4:62484632-62484654 CTTTGAACCCAGCTGGATCACGG - Intergenic
975233599 4:71964482-71964504 CTTTTAACTCACCTTTAACATGG + Intergenic
976509392 4:85890748-85890770 CTTTGCACACCACTGCAACTGGG + Intronic
980561633 4:134484645-134484667 CTTTGGAGACCTCTGCAACAGGG - Intergenic
981357791 4:143811072-143811094 ATTTGAACATACCTGAAACTGGG + Intergenic
983874263 4:172857946-172857968 CTTTGAAAATACCTTAAACATGG + Intronic
987708376 5:21482518-21482540 CTTTGTCCTCACTTGCAACAGGG - Intergenic
987708552 5:21483325-21483347 CTTTGTCCTCACTTGCAACAGGG - Intergenic
988751059 5:34190820-34190842 CTTTGTCCTCACTTGCAACAGGG + Intergenic
988751238 5:34191630-34191652 CTTTGTCCTCACTTGCAACAGGG + Intergenic
988751408 5:34192437-34192459 CTTTGTCCTCACTTGCAACAGGG + Intergenic
988751579 5:34193253-34193275 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991136590 5:63189470-63189492 CTTAGAACAGACCTACAGCATGG + Intergenic
991736200 5:69632744-69632766 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991736546 5:69634364-69634386 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991736723 5:69635180-69635202 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991736896 5:69635999-69636021 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991739332 5:69654032-69654054 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991758169 5:69899147-69899169 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991758343 5:69899963-69899985 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991758519 5:69900779-69900801 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991758690 5:69901592-69901614 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991758866 5:69902399-69902421 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991788470 5:70215723-70215745 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991790907 5:70233773-70233795 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991812697 5:70488383-70488405 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991813048 5:70490009-70490031 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991813221 5:70490828-70490850 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991815658 5:70508860-70508882 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991815828 5:70509667-70509689 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991816000 5:70510480-70510502 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991816176 5:70511290-70511312 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991816353 5:70512109-70512131 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991818793 5:70530149-70530171 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991837572 5:70775029-70775051 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991837748 5:70775845-70775867 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991837919 5:70776658-70776680 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991838095 5:70777465-70777487 CTTTGTCCTCACTTGCAACAGGG - Intergenic
991880917 5:71216087-71216109 CTTTGTCCTCACTTGCAACAGGG + Intergenic
991883354 5:71234108-71234130 CTTTGTCCTCACTTGCAACAGGG + Intergenic
994420274 5:99522713-99522735 CTTTGTCCTCACTTGCAACAGGG - Intergenic
994420444 5:99523532-99523554 CTTTGTCCTCACTTGCAACAGGG - Intergenic
994486428 5:100389963-100389985 CTTTGTCCTCACTTGCAACAGGG + Intergenic
994486599 5:100390782-100390804 CTTTGTCCTCACTTGCAACAGGG + Intergenic
994486766 5:100391601-100391623 CTTTGTCCTCACTTGCAACAGGG + Intergenic
994486931 5:100392420-100392442 CTTTGTCCTCACTTGCAACAGGG + Intergenic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1002994589 6:2270868-2270890 CTTTGAATACACCTGTGACCTGG - Intergenic
1003903985 6:10681912-10681934 CTTTTAACACATGTGCAATAAGG + Intronic
1008691900 6:53988413-53988435 CCTTGACCACACCCACAACAAGG - Intronic
1012021397 6:93925530-93925552 CTTTGCACTCACATGCACCAAGG - Intergenic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1015700682 6:136032989-136033011 CTTAGAAAACAGCTACAACAAGG - Intronic
1017050379 6:150387245-150387267 CATTAAACACAGCTGCTACAAGG - Intronic
1020560395 7:9723883-9723905 TTTTAAATAAACCTGCAACAAGG - Intergenic
1024304312 7:47914473-47914495 CTATGAAGACCCCTGCAGCATGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1029518568 7:101044483-101044505 CTTTGATAAAACCTGCATCAAGG + Intronic
1029649086 7:101878544-101878566 CTTTGAACAAAACTGCATCAAGG - Intronic
1029997473 7:105021744-105021766 CTTTGAACATTCCTGGAAAAAGG - Intronic
1030588943 7:111455916-111455938 ATTTGAACATACCTGAAACTGGG - Intronic
1030925905 7:115454229-115454251 CATTGAATTCACCTGCAAGAAGG + Intergenic
1031772991 7:125869475-125869497 CTTTGAAAACCACTGCAATAGGG + Intergenic
1032266946 7:130376137-130376159 CCCTGAACACACCTGCCAAAGGG + Intergenic
1033017606 7:137687843-137687865 CTTTCAACAGACCTCCAAGATGG + Intronic
1035781525 8:2231881-2231903 CTTTGACCATACCTACAACACGG + Intergenic
1039799361 8:40940901-40940923 CTTTGAATCCACCTGTAACCAGG - Intergenic
1045502681 8:102755566-102755588 CTTTGAAAACAACTGCAGCTTGG + Intergenic
1048880961 8:138872257-138872279 CTATGAACACATCCACAACAGGG + Intronic
1049120272 8:140730848-140730870 TTTTGAACATACCTGCAAAAAGG + Intronic
1050903120 9:10970270-10970292 GTTTGAACATAGCTGCAAAATGG - Intergenic
1052356079 9:27506079-27506101 CCTGGAACACACCAGCAATAAGG - Intronic
1052876763 9:33573736-33573758 CTTTGAACACAGCTGCTCAAGGG + Intergenic
1053020924 9:34693417-34693439 CTTTGAGAACAACTGCCACAGGG - Intergenic
1053499240 9:38570650-38570672 CTTTGAACACAGCTGCTCAAGGG - Intronic
1054344347 9:63899825-63899847 CTGTGAACAGCCCTGCAGCAGGG - Intergenic
1055694425 9:78868390-78868412 CTTTGAGCACACCTGGAGGATGG - Intergenic
1055893022 9:81143299-81143321 CTGTGAAGGCATCTGCAACATGG - Intergenic
1057678659 9:97155131-97155153 CTTTGAACACAGCTGCTCAAGGG - Intergenic
1057847010 9:98533548-98533570 CACTGAACATACCTGCACCAGGG + Intronic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1186129224 X:6448387-6448409 CTTTGTACACACCTATACCATGG - Intergenic
1186387247 X:9122333-9122355 CTATAAACACAACTGCACCAAGG + Intronic
1187402096 X:18969848-18969870 CTTTTAAAACACCTGAAATATGG - Intronic
1194971192 X:100346140-100346162 GTTTGAAAACACCTAGAACAGGG + Intronic
1196194872 X:112829063-112829085 TATTGAACAGACCTGGAACAGGG - Intronic
1196233433 X:113252572-113252594 CTCTGGACACACCTGGAACTGGG - Intergenic
1197654455 X:129101540-129101562 CTCTAAACAAGCCTGCAACAGGG + Intergenic