ID: 1179162046

View in Genome Browser
Species Human (GRCh38)
Location 21:38906825-38906847
Sequence GTCCTTTGTCTTCCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179162046_1179162051 7 Left 1179162046 21:38906825-38906847 CCATGGCCAGGAAGACAAAGGAC No data
Right 1179162051 21:38906855-38906877 AGAAGCCCCCGTGCCTAACATGG No data
1179162046_1179162057 30 Left 1179162046 21:38906825-38906847 CCATGGCCAGGAAGACAAAGGAC No data
Right 1179162057 21:38906878-38906900 TGCCGTGCTGCCACTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179162046 Original CRISPR GTCCTTTGTCTTCCTGGCCA TGG (reversed) Intergenic
No off target data available for this crispr