ID: 1179163985

View in Genome Browser
Species Human (GRCh38)
Location 21:38920823-38920845
Sequence GGCTGCAAACAGATGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179163974_1179163985 27 Left 1179163974 21:38920773-38920795 CCATGGGCGTGATGATTCTTGAC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG 0: 1
1: 0
2: 0
3: 16
4: 149
1179163981_1179163985 -10 Left 1179163981 21:38920810-38920832 CCCCAGGAACAGGGGCTGCAAAC 0: 1
1: 0
2: 0
3: 20
4: 204
Right 1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179163985 Original CRISPR GGCTGCAAACAGATGAGCTA GGG Intergenic
903533691 1:24052307-24052329 GGCTGGAGCCAGAGGAGCTAAGG - Intergenic
904383655 1:30127821-30127843 GGATGAATACAGATGAGCTGGGG - Intergenic
905931124 1:41788360-41788382 GGCTGCATCCAGATGAGCATAGG + Intronic
907333000 1:53683622-53683644 GGCTAGAAACAGAAGAGCTAAGG - Intronic
909523355 1:76594835-76594857 GGCTGTAGACAGATGAGGAATGG - Intronic
910118644 1:83760353-83760375 AGCTTCAAAGAGATGAGCTACGG + Intergenic
910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG + Exonic
911456245 1:98127838-98127860 AGGTGCAAACAGATGTGGTACGG + Intergenic
912448780 1:109757355-109757377 GGGTGGAACCAGATGAGCTGGGG - Intronic
913329362 1:117654324-117654346 GGCTTCAATTCGATGAGCTAGGG + Intergenic
915038748 1:152949965-152949987 GGCTGAAAAGAGTTGAGATAAGG + Intergenic
918131595 1:181634310-181634332 GGCTGCACAAAGATTATCTAAGG + Intronic
918563461 1:185897588-185897610 GGATGCAAACGGATGAGCAGAGG - Intronic
1062851424 10:745674-745696 GGCTGCATAAAGATGAGCATTGG - Intergenic
1064110574 10:12535204-12535226 GGCTGCGCACAGATGTGCAAAGG - Intronic
1065307416 10:24382191-24382213 GTTTGCAAACAGATGGGCTTGGG + Intronic
1065462661 10:25985019-25985041 GGCTGCAAACTCCTGAGCTCAGG - Intronic
1067069983 10:43124241-43124263 GGCTGAGAACAGATGAGAAAGGG + Intronic
1069626326 10:69869812-69869834 GACTGAAAACAGATGACCAAGGG + Intronic
1069959414 10:72070759-72070781 GGTTGCAAACTGATGACCTCTGG + Intronic
1072570564 10:96654486-96654508 GGCTGCACACACATGTGCTGTGG + Intronic
1075870118 10:125766091-125766113 GGATACAAACAGATGAACTTTGG + Intergenic
1076048258 10:127312384-127312406 GGCTGCAAACACAAGAGATCTGG + Intronic
1076354087 10:129839820-129839842 GGCTGCAAGCCCAGGAGCTATGG + Intronic
1076868375 10:133180501-133180523 GGCTTCAAACAGATTAGGTCTGG + Intronic
1078327893 11:10395424-10395446 GGCCTTAAACTGATGAGCTAAGG + Intronic
1084006801 11:66327278-66327300 GGCTGGAATCTGATGAGCTCAGG + Intergenic
1089626211 11:119752573-119752595 GGCTGGGAACAGAAGAGCCAAGG - Intergenic
1089749788 11:120642785-120642807 GACAGCAAACAGATGAGGTGAGG - Intronic
1092071176 12:5632659-5632681 GGCTTCAAACAGAAGAGTTAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093807047 12:23447089-23447111 GGATACAAACAAATGACCTAAGG + Intergenic
1093926495 12:24913560-24913582 GGATGCAAACCCATGAGCTGGGG + Intronic
1094727414 12:33134310-33134332 GGCTGCATACAGAGAAGCTGTGG - Intergenic
1096641696 12:52999778-52999800 GGGTACAAACAGTTCAGCTAAGG - Intergenic
1100415889 12:94374206-94374228 GTCAGCACACAGGTGAGCTAGGG + Intronic
1100701835 12:97157132-97157154 GGCTGCAAACTCATGAGCCTTGG - Intergenic
1104303636 12:127589548-127589570 GGCTGACCACAGCTGAGCTATGG - Intergenic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1105581695 13:21704067-21704089 GGATGCAAACCCATGAGCTGGGG - Exonic
1106897662 13:34322279-34322301 GGCTGCAAAAGGATGCGCCATGG + Intergenic
1107054717 13:36090606-36090628 GGAAGCAAAGAGATCAGCTAGGG + Intronic
1107107365 13:36659492-36659514 AGCTGCAAGCAGAGGAACTAAGG + Intergenic
1108692937 13:52876091-52876113 GTGAGCAAACAGATGAGCTGTGG - Intergenic
1112146095 13:96702036-96702058 GGCTGCATAGAGATGAGCACTGG + Intronic
1112427788 13:99319559-99319581 GGCTGCAAGCATATCAGCTGTGG - Intronic
1115045307 14:28985368-28985390 GTATGCAAACACATGAGCTGTGG + Intergenic
1117518530 14:56527095-56527117 GACTGCAAACTGCAGAGCTAAGG - Intronic
1120781972 14:88493629-88493651 GACTGCATACAGATGAGATAGGG + Intronic
1123980321 15:25596363-25596385 GCCTGGAAACAGATGGTCTATGG - Intergenic
1125678817 15:41517792-41517814 GGCTGCTGGCAGATGAGGTAGGG - Exonic
1129738625 15:77979156-77979178 GGCTGCAGACTGGGGAGCTAGGG - Intergenic
1129847447 15:78774458-78774480 GGCTGCAGACTGGGGAGCTAGGG + Intronic
1130254456 15:82319454-82319476 GGCTGCAGACTGGGGAGCTAGGG - Intergenic
1130600509 15:85270516-85270538 GGCTGCAGACTGGGGAGCTAGGG + Intergenic
1137762969 16:50955586-50955608 GGCTGCAAACAGAGCAGATCTGG - Intergenic
1138760075 16:59533111-59533133 GGCTGCAAGCAGATCAGCAGCGG + Intergenic
1138880106 16:61002932-61002954 ATTTGCAAACACATGAGCTAAGG - Intergenic
1141874575 16:86814137-86814159 TGCTGCAAACACATGAGCAGTGG - Intergenic
1142505032 17:357843-357865 GGCAGGAAAGAGAAGAGCTAGGG - Intronic
1143462023 17:7109942-7109964 TGCTGCAAAGAGAGGAGCTCAGG - Intronic
1148452028 17:47784962-47784984 CACTGAAAACAGATGAGCTATGG + Intergenic
1150456543 17:65310998-65311020 GGCTGCAGAGAAATGAGCTAAGG + Intergenic
1150588384 17:66539069-66539091 GCCTGTGAACAGATGAGCTTTGG - Intronic
1152603594 17:81277831-81277853 GGCTGCACACAGATGCTCCATGG - Intronic
1153552545 18:6276494-6276516 AATTGCAAACATATGAGCTAAGG + Intronic
1154327798 18:13404398-13404420 AGCTGCAATCAGAGGAGCTGTGG + Intronic
1158590838 18:58777508-58777530 GGCTGCTCAGAGCTGAGCTAGGG - Intergenic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1160092102 18:75837266-75837288 GGCTGAAGACAGACGAGATAGGG + Intergenic
1160241975 18:77131569-77131591 GGCTGGAAACAGGCGAGCTCTGG - Intronic
1160425501 18:78776270-78776292 AGCTGGAGACAGATGAGCTCAGG - Intergenic
1160748812 19:724062-724084 GGCTGCAGACAGATGAGGAGAGG + Intronic
1161063747 19:2227764-2227786 GGCTCCAAACGGATGAGCAGAGG - Intronic
1161178394 19:2862562-2862584 GGCTGCAGACACAGGAACTAGGG - Intergenic
1163372472 19:16909064-16909086 TGCTGGAATCAGATGAGCTGGGG - Intronic
1164803113 19:31093939-31093961 GCCTGGAGAAAGATGAGCTATGG + Intergenic
1165752074 19:38266248-38266270 GGCTGCAGCCAGATGGCCTAGGG + Intronic
1166132988 19:40757724-40757746 GGCTGCAAACTCCTGAGCTCAGG - Intronic
1166687898 19:44807116-44807138 GGCTGGGGACAGAAGAGCTAGGG + Intergenic
925080749 2:1063247-1063269 GGCTCCTCACAGATGAGCTAAGG + Intronic
930084336 2:47483381-47483403 GGCTGCATACGAATTAGCTAAGG + Intronic
934681239 2:96285457-96285479 GAGTGCAGACAGAGGAGCTAAGG + Intronic
938591859 2:132747226-132747248 GGTTGAACACAGATGAGCAAAGG + Intronic
941708208 2:168682502-168682524 TGCTAAAACCAGATGAGCTACGG - Intronic
942285671 2:174413432-174413454 GACTGCAAGCAGCTCAGCTAAGG - Intronic
946394441 2:219436045-219436067 TGGTGCAAACAGGTGAGGTATGG + Intronic
1169822430 20:9727261-9727283 GGTTGCAAACTGATGACCCAAGG + Intronic
1173241635 20:41302229-41302251 GGCAGCAGAGAAATGAGCTAGGG - Intronic
1174237219 20:49103835-49103857 GGCAGAAAAAAGATGAGCTGTGG + Intergenic
1176024648 20:62979559-62979581 GGGCGCAAACAGCTGAGCCAGGG + Intergenic
1177731215 21:25028769-25028791 GTCTGTCAACAGATGACCTATGG + Intergenic
1178723272 21:35028948-35028970 CACTGCAGACAGATGAGCTAGGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179359134 21:40689305-40689327 TGCTTCTAACAGATGAGCTTTGG - Intronic
1179391072 21:40991835-40991857 TGCTGCAACAAGTTGAGCTAAGG - Intergenic
1180245809 21:46546545-46546567 GACTGAAAACTGCTGAGCTAAGG - Intronic
1182876321 22:33694289-33694311 AGCTGGAAACAGAATAGCTATGG - Intronic
1183134630 22:35874845-35874867 GGGTGCAAAGAGGTGAGTTAGGG - Intronic
1183729847 22:39612014-39612036 GGTTGCCAACACATGAACTATGG - Intronic
1185331879 22:50255609-50255631 GGCTGCAGAGCGATGAGGTAAGG - Exonic
949713465 3:6899105-6899127 GTCGGAAAACACATGAGCTAAGG + Intronic
951540258 3:23775712-23775734 GGCAGTAAATAGCTGAGCTAAGG + Intergenic
953032078 3:39185832-39185854 GGCTGCACACAGATGGCCTGGGG - Exonic
953996272 3:47522437-47522459 GGCTCCAGAGAGATGAGCTAAGG - Intergenic
956882927 3:73529379-73529401 GGCTGCAAACAGGTGACCTGAGG + Intronic
958019791 3:87981105-87981127 TGCTGCAAACAGACCAGCTGTGG - Intergenic
962684055 3:137829372-137829394 GAGTGCAAACTGATGAGCTCTGG + Intergenic
963902025 3:150742189-150742211 ATCTGCAAAAAGATGTGCTATGG + Exonic
964402158 3:156310894-156310916 GGCTTCAAGAAAATGAGCTAGGG + Intronic
964664093 3:159152880-159152902 ATCTGCAAAAAGATGAGATAAGG + Intronic
967523042 3:190457657-190457679 GGCAGATAACAGATGAGCAAAGG + Intergenic
969704468 4:8784389-8784411 GGCTGCACACAGAGGAGCCCGGG + Intergenic
970083829 4:12322499-12322521 GGATGTAAACAAATAAGCTATGG - Intergenic
970752264 4:19378037-19378059 GGTTGAAGACAGAGGAGCTAGGG - Intergenic
972401676 4:38710055-38710077 GGCTACCCACAGATGAGCCAGGG - Intergenic
976346889 4:84013978-84014000 AGCTGTACACAGATGAGTTAAGG + Intergenic
976473078 4:85452244-85452266 GGATGCAGACAGCTGAGCAAAGG + Intergenic
977427125 4:96881330-96881352 GTCTGCTAACATAAGAGCTAAGG - Intergenic
978228234 4:106364731-106364753 GGCAGCAAGGAGATGAGCTAGGG - Intergenic
978401981 4:108340938-108340960 AGCTGCCAACAAATGGGCTAGGG + Intergenic
986085848 5:4445222-4445244 GATTGCAAACAGCTCAGCTAAGG + Intergenic
988969976 5:36457304-36457326 GGCTGCAGAGGGATGAGATATGG + Intergenic
990737208 5:58877348-58877370 GGCTGCAATCTAATGAGCAATGG - Intergenic
991244064 5:64490137-64490159 GGCTGCACACACATCAGCTAGGG - Intergenic
992524321 5:77592848-77592870 GACTGGAAACTGATTAGCTAAGG - Intronic
992835844 5:80640478-80640500 GCATGCAAAAAGCTGAGCTACGG + Intronic
992878516 5:81081690-81081712 GGCTGCAAAATGATTAGCCAGGG - Intronic
993067673 5:83119912-83119934 GGCTGCAGTGAGATAAGCTAAGG + Intronic
994752142 5:103751463-103751485 GGAAGCAAACAGATCAGCTGGGG + Intergenic
997487639 5:134245112-134245134 GGCTGCAGGCAGATGAAGTATGG + Intergenic
997526522 5:134556315-134556337 GGCAGCACACAGCTGAGCCAAGG + Intronic
999094576 5:148966520-148966542 GGCTGCAGACAGCTCAGCTTGGG + Intronic
1006444168 6:34069584-34069606 GGCTGGAGACTGATGAGCTGGGG - Intronic
1016684119 6:146862281-146862303 GTCAGCAAACAAATGGGCTAAGG - Intergenic
1017322137 6:153106365-153106387 GGCTGAAAACAGCTGAGGAAAGG + Intronic
1017508838 6:155093974-155093996 GGCTGCAAACTGGTGAGTTTTGG + Intronic
1018177059 6:161186354-161186376 GGCTGCAAATAGAGGAGCCCTGG - Intronic
1020530525 7:9328515-9328537 GGCTGAATTCAGATGAGCCAGGG - Intergenic
1021122815 7:16816080-16816102 GGCTGGAATCACATGAGCTGGGG + Intronic
1022967095 7:35483848-35483870 GGCTGCAACCAAATGAGTGAGGG + Intergenic
1023695790 7:42844927-42844949 GGCTGCAAAGATTTGAGATATGG + Intergenic
1024636243 7:51292771-51292793 GGCTGCAAAGAGTTGGGCTTGGG - Intronic
1024818084 7:53294568-53294590 GTTTGCAAACAGGTGAACTAAGG + Intergenic
1026560457 7:71444218-71444240 GGCTGCAAACACCTGAGCCTTGG + Intronic
1028296847 7:89143366-89143388 GGCTGAATTTAGATGAGCTATGG + Intronic
1034921946 7:155090660-155090682 AGCTGCAAACAAATCAGCCAGGG + Intergenic
1035918847 8:3654899-3654921 GGCTCCACACAGTTGAGCCAGGG + Intronic
1035980255 8:4362339-4362361 GGGGGCAGACAGATGAGCTTGGG - Intronic
1039800138 8:40947142-40947164 AGGAACAAACAGATGAGCTATGG + Intergenic
1039831476 8:41218665-41218687 GGCTGCAGTCAGATCAGCCATGG - Intergenic
1041891255 8:62871600-62871622 GGCTGCAAACAGCTGAAGTCAGG + Intronic
1044616834 8:94151372-94151394 GGCTCCAAAGAGCTGATCTAGGG - Intronic
1047106445 8:121735857-121735879 CGCTGTAAACAGATGTGCTGTGG + Intergenic
1051077247 9:13253755-13253777 GGCAGAAAAGAGATGAGCTATGG + Intronic
1052487552 9:29121171-29121193 TGATGCACACAGATGAGCTGAGG + Intergenic
1053444039 9:38137724-38137746 GGCTGCTCACAGTTCAGCTATGG - Intergenic
1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG + Intergenic
1055282494 9:74690555-74690577 GGCTGCAAGCTGACGATCTATGG - Exonic
1186194448 X:7097247-7097269 GAAAGCAAACAGATGAGCTGGGG + Intronic
1188147355 X:26630259-26630281 GGCTGCCAGCATAAGAGCTATGG + Intergenic
1192227994 X:69242559-69242581 GGCAGCAGGCAGATGAGCTCAGG + Intergenic
1197674795 X:129317670-129317692 GGTTGGAAACAGATGACCTCTGG - Intergenic
1198631378 X:138642462-138642484 GGATGCAATGAGATGATCTAGGG + Intronic
1202132133 Y:21622310-21622332 GCATGAAAACAAATGAGCTAAGG + Intergenic