ID: 1179165448

View in Genome Browser
Species Human (GRCh38)
Location 21:38931987-38932009
Sequence CCTGGCAACCGCCAGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179165440_1179165448 -5 Left 1179165440 21:38931969-38931991 CCCAGAACCCCAAGGATCCCTGG No data
Right 1179165448 21:38931987-38932009 CCTGGCAACCGCCAGAAACCAGG No data
1179165442_1179165448 -6 Left 1179165442 21:38931970-38931992 CCAGAACCCCAAGGATCCCTGGC No data
Right 1179165448 21:38931987-38932009 CCTGGCAACCGCCAGAAACCAGG No data
1179165439_1179165448 -4 Left 1179165439 21:38931968-38931990 CCCCAGAACCCCAAGGATCCCTG No data
Right 1179165448 21:38931987-38932009 CCTGGCAACCGCCAGAAACCAGG No data
1179165437_1179165448 24 Left 1179165437 21:38931940-38931962 CCATGGGATGGGAGGCATTTGCT No data
Right 1179165448 21:38931987-38932009 CCTGGCAACCGCCAGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179165448 Original CRISPR CCTGGCAACCGCCAGAAACC AGG Intergenic