ID: 1179166396

View in Genome Browser
Species Human (GRCh38)
Location 21:38938525-38938547
Sequence TACCATGGCAACAGTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179166396_1179166399 8 Left 1179166396 21:38938525-38938547 CCAGGGACACTGTTGCCATGGTA No data
Right 1179166399 21:38938556-38938578 CTCCACTTCCTGCCTTACCCGGG No data
1179166396_1179166398 7 Left 1179166396 21:38938525-38938547 CCAGGGACACTGTTGCCATGGTA No data
Right 1179166398 21:38938555-38938577 TCTCCACTTCCTGCCTTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179166396 Original CRISPR TACCATGGCAACAGTGTCCC TGG (reversed) Intergenic
No off target data available for this crispr