ID: 1179167536

View in Genome Browser
Species Human (GRCh38)
Location 21:38946603-38946625
Sequence CTGCAGACATAGTCGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179167536_1179167543 20 Left 1179167536 21:38946603-38946625 CCATCTGCCGACTATGTCTGCAG No data
Right 1179167543 21:38946646-38946668 ACCATTTCTTCTTCTCTGTGGGG No data
1179167536_1179167541 18 Left 1179167536 21:38946603-38946625 CCATCTGCCGACTATGTCTGCAG No data
Right 1179167541 21:38946644-38946666 AGACCATTTCTTCTTCTCTGTGG No data
1179167536_1179167545 23 Left 1179167536 21:38946603-38946625 CCATCTGCCGACTATGTCTGCAG No data
Right 1179167545 21:38946649-38946671 ATTTCTTCTTCTCTGTGGGGAGG No data
1179167536_1179167542 19 Left 1179167536 21:38946603-38946625 CCATCTGCCGACTATGTCTGCAG No data
Right 1179167542 21:38946645-38946667 GACCATTTCTTCTTCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179167536 Original CRISPR CTGCAGACATAGTCGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr