ID: 1179167587

View in Genome Browser
Species Human (GRCh38)
Location 21:38946828-38946850
Sequence GTGGAAGCCCATATATCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179167582_1179167587 -9 Left 1179167582 21:38946814-38946836 CCCCAGGGACATATGTGGAAGCC No data
Right 1179167587 21:38946828-38946850 GTGGAAGCCCATATATCTTGGGG No data
1179167579_1179167587 6 Left 1179167579 21:38946799-38946821 CCTGTAGGGCAGGAGCCCCAGGG No data
Right 1179167587 21:38946828-38946850 GTGGAAGCCCATATATCTTGGGG No data
1179167583_1179167587 -10 Left 1179167583 21:38946815-38946837 CCCAGGGACATATGTGGAAGCCC No data
Right 1179167587 21:38946828-38946850 GTGGAAGCCCATATATCTTGGGG No data
1179167577_1179167587 15 Left 1179167577 21:38946790-38946812 CCAAGCACTCCTGTAGGGCAGGA No data
Right 1179167587 21:38946828-38946850 GTGGAAGCCCATATATCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179167587 Original CRISPR GTGGAAGCCCATATATCTTG GGG Intergenic
No off target data available for this crispr