ID: 1179170704

View in Genome Browser
Species Human (GRCh38)
Location 21:38970733-38970755
Sequence CCGTGGGAAGAGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179170704_1179170716 21 Left 1179170704 21:38970733-38970755 CCACCTGCCCTCTCTTCCCACGG No data
Right 1179170716 21:38970777-38970799 CACCCATCTATACCCCCTTATGG No data
1179170704_1179170717 22 Left 1179170704 21:38970733-38970755 CCACCTGCCCTCTCTTCCCACGG No data
Right 1179170717 21:38970778-38970800 ACCCATCTATACCCCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179170704 Original CRISPR CCGTGGGAAGAGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr