ID: 1179170802

View in Genome Browser
Species Human (GRCh38)
Location 21:38971309-38971331
Sequence TGCACTCATGTCCCTCCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179170796_1179170802 20 Left 1179170796 21:38971266-38971288 CCCAGAGAGGTGTGAGGCAGGAA No data
Right 1179170802 21:38971309-38971331 TGCACTCATGTCCCTCCGCAGGG No data
1179170793_1179170802 24 Left 1179170793 21:38971262-38971284 CCTCCCCAGAGAGGTGTGAGGCA No data
Right 1179170802 21:38971309-38971331 TGCACTCATGTCCCTCCGCAGGG No data
1179170797_1179170802 19 Left 1179170797 21:38971267-38971289 CCAGAGAGGTGTGAGGCAGGAAC No data
Right 1179170802 21:38971309-38971331 TGCACTCATGTCCCTCCGCAGGG No data
1179170795_1179170802 21 Left 1179170795 21:38971265-38971287 CCCCAGAGAGGTGTGAGGCAGGA No data
Right 1179170802 21:38971309-38971331 TGCACTCATGTCCCTCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179170802 Original CRISPR TGCACTCATGTCCCTCCGCA GGG Intergenic
No off target data available for this crispr