ID: 1179172717

View in Genome Browser
Species Human (GRCh38)
Location 21:38985212-38985234
Sequence ACATAATAATTTGCAGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179172717_1179172720 20 Left 1179172717 21:38985212-38985234 CCAACATCTGCAAATTATTATGT No data
Right 1179172720 21:38985255-38985277 GCCACCGCAGGCTGCCCCCACGG No data
1179172717_1179172718 8 Left 1179172717 21:38985212-38985234 CCAACATCTGCAAATTATTATGT No data
Right 1179172718 21:38985243-38985265 AAAAAATCAACCGCCACCGCAGG No data
1179172717_1179172723 27 Left 1179172717 21:38985212-38985234 CCAACATCTGCAAATTATTATGT No data
Right 1179172723 21:38985262-38985284 CAGGCTGCCCCCACGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179172717 Original CRISPR ACATAATAATTTGCAGATGT TGG (reversed) Intergenic