ID: 1179172720

View in Genome Browser
Species Human (GRCh38)
Location 21:38985255-38985277
Sequence GCCACCGCAGGCTGCCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179172717_1179172720 20 Left 1179172717 21:38985212-38985234 CCAACATCTGCAAATTATTATGT No data
Right 1179172720 21:38985255-38985277 GCCACCGCAGGCTGCCCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179172720 Original CRISPR GCCACCGCAGGCTGCCCCCA CGG Intergenic
No off target data available for this crispr