ID: 1179174125

View in Genome Browser
Species Human (GRCh38)
Location 21:38995171-38995193
Sequence CCTCACATACAAAAGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179174125_1179174132 11 Left 1179174125 21:38995171-38995193 CCAAGCACCTTTTGTATGTGAGG No data
Right 1179174132 21:38995205-38995227 TCACCGGGCCTGCGGCAGGAAGG No data
1179174125_1179174131 7 Left 1179174125 21:38995171-38995193 CCAAGCACCTTTTGTATGTGAGG No data
Right 1179174131 21:38995201-38995223 CTAGTCACCGGGCCTGCGGCAGG No data
1179174125_1179174128 -5 Left 1179174125 21:38995171-38995193 CCAAGCACCTTTTGTATGTGAGG No data
Right 1179174128 21:38995189-38995211 TGAGGTGCTGTTCTAGTCACCGG No data
1179174125_1179174130 3 Left 1179174125 21:38995171-38995193 CCAAGCACCTTTTGTATGTGAGG No data
Right 1179174130 21:38995197-38995219 TGTTCTAGTCACCGGGCCTGCGG No data
1179174125_1179174129 -4 Left 1179174125 21:38995171-38995193 CCAAGCACCTTTTGTATGTGAGG No data
Right 1179174129 21:38995190-38995212 GAGGTGCTGTTCTAGTCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179174125 Original CRISPR CCTCACATACAAAAGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr