ID: 1179175989

View in Genome Browser
Species Human (GRCh38)
Location 21:39008699-39008721
Sequence TCCTCTCTGAGGTGACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179175989_1179175993 21 Left 1179175989 21:39008699-39008721 CCACCTTGTCACCTCAGAGAGGA No data
Right 1179175993 21:39008743-39008765 GCCTGTTCCTGGTTTCTATGAGG No data
1179175989_1179175992 10 Left 1179175989 21:39008699-39008721 CCACCTTGTCACCTCAGAGAGGA No data
Right 1179175992 21:39008732-39008754 AAGCTGTTTGAGCCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179175989 Original CRISPR TCCTCTCTGAGGTGACAAGG TGG (reversed) Intergenic
No off target data available for this crispr