ID: 1179183097

View in Genome Browser
Species Human (GRCh38)
Location 21:39061976-39061998
Sequence CCTGCATCCCCATGTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179183088_1179183097 21 Left 1179183088 21:39061932-39061954 CCTGCTAGATGGGACCGGATGAG No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data
1179183095_1179183097 -8 Left 1179183095 21:39061961-39061983 CCAGGGGACGAACTTCCTGCATC No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data
1179183094_1179183097 -5 Left 1179183094 21:39061958-39061980 CCACCAGGGGACGAACTTCCTGC No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data
1179183093_1179183097 -2 Left 1179183093 21:39061955-39061977 CCACCACCAGGGGACGAACTTCC No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data
1179183092_1179183097 7 Left 1179183092 21:39061946-39061968 CCGGATGAGCCACCACCAGGGGA No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data
1179183086_1179183097 26 Left 1179183086 21:39061927-39061949 CCACTCCTGCTAGATGGGACCGG No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data
1179183085_1179183097 27 Left 1179183085 21:39061926-39061948 CCCACTCCTGCTAGATGGGACCG No data
Right 1179183097 21:39061976-39061998 CCTGCATCCCCATGTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179183097 Original CRISPR CCTGCATCCCCATGTGCCCC TGG Intergenic
No off target data available for this crispr