ID: 1179183176

View in Genome Browser
Species Human (GRCh38)
Location 21:39062275-39062297
Sequence TACCCACAGCTGCCCACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179183163_1179183176 29 Left 1179183163 21:39062223-39062245 CCCCTCTGCGGGGTCCCCACACA No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183167_1179183176 14 Left 1179183167 21:39062238-39062260 CCCACACATGAGTCCCCATGCCT No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183166_1179183176 15 Left 1179183166 21:39062237-39062259 CCCCACACATGAGTCCCCATGCC No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183165_1179183176 27 Left 1179183165 21:39062225-39062247 CCTCTGCGGGGTCCCCACACATG No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183164_1179183176 28 Left 1179183164 21:39062224-39062246 CCCTCTGCGGGGTCCCCACACAT No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183169_1179183176 1 Left 1179183169 21:39062251-39062273 CCCCATGCCTGATCCCAGACGTT No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183171_1179183176 -1 Left 1179183171 21:39062253-39062275 CCATGCCTGATCCCAGACGTTCT No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183172_1179183176 -6 Left 1179183172 21:39062258-39062280 CCTGATCCCAGACGTTCTACCCA No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183170_1179183176 0 Left 1179183170 21:39062252-39062274 CCCATGCCTGATCCCAGACGTTC No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183168_1179183176 13 Left 1179183168 21:39062239-39062261 CCACACATGAGTCCCCATGCCTG No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data
1179183162_1179183176 30 Left 1179183162 21:39062222-39062244 CCCCCTCTGCGGGGTCCCCACAC No data
Right 1179183176 21:39062275-39062297 TACCCACAGCTGCCCACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179183176 Original CRISPR TACCCACAGCTGCCCACGGC AGG Intergenic
No off target data available for this crispr