ID: 1179188098

View in Genome Browser
Species Human (GRCh38)
Location 21:39100355-39100377
Sequence AAACCCTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179188098_1179188100 20 Left 1179188098 21:39100355-39100377 CCTATCTTTGTGAAGCAGGGTTT No data
Right 1179188100 21:39100398-39100420 AACGAGATCACAAAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179188098 Original CRISPR AAACCCTGCTTCACAAAGAT AGG (reversed) Intergenic