ID: 1179188485

View in Genome Browser
Species Human (GRCh38)
Location 21:39103703-39103725
Sequence CTGCTACTGACTTGGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179188485_1179188500 26 Left 1179188485 21:39103703-39103725 CCTGAAATCCAAGTCAGTAGCAG No data
Right 1179188500 21:39103752-39103774 TCCAGGGATGGAGCTTCCCAGGG No data
1179188485_1179188499 25 Left 1179188485 21:39103703-39103725 CCTGAAATCCAAGTCAGTAGCAG No data
Right 1179188499 21:39103751-39103773 TTCCAGGGATGGAGCTTCCCAGG No data
1179188485_1179188494 10 Left 1179188485 21:39103703-39103725 CCTGAAATCCAAGTCAGTAGCAG No data
Right 1179188494 21:39103736-39103758 CAAAGATCCCTTCCATTCCAGGG No data
1179188485_1179188493 9 Left 1179188485 21:39103703-39103725 CCTGAAATCCAAGTCAGTAGCAG No data
Right 1179188493 21:39103735-39103757 CCAAAGATCCCTTCCATTCCAGG No data
1179188485_1179188495 14 Left 1179188485 21:39103703-39103725 CCTGAAATCCAAGTCAGTAGCAG No data
Right 1179188495 21:39103740-39103762 GATCCCTTCCATTCCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179188485 Original CRISPR CTGCTACTGACTTGGATTTC AGG (reversed) Intergenic
No off target data available for this crispr