ID: 1179189340

View in Genome Browser
Species Human (GRCh38)
Location 21:39109397-39109419
Sequence TGTCCACCCTGGACACAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179189340_1179189345 30 Left 1179189340 21:39109397-39109419 CCCGACTGTGTCCAGGGTGGACA No data
Right 1179189345 21:39109450-39109472 AAGAGCTCTGTTTCAGATGGAGG No data
1179189340_1179189344 27 Left 1179189340 21:39109397-39109419 CCCGACTGTGTCCAGGGTGGACA No data
Right 1179189344 21:39109447-39109469 CTCAAGAGCTCTGTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179189340 Original CRISPR TGTCCACCCTGGACACAGTC GGG (reversed) Intergenic
No off target data available for this crispr