ID: 1179190355

View in Genome Browser
Species Human (GRCh38)
Location 21:39117618-39117640
Sequence CTGTCCTAACAGCAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179190355_1179190361 8 Left 1179190355 21:39117618-39117640 CCACCCTGCTGCTGTTAGGACAG No data
Right 1179190361 21:39117649-39117671 AGTCAGGAGCAACAGATAAAAGG No data
1179190355_1179190358 -8 Left 1179190355 21:39117618-39117640 CCACCCTGCTGCTGTTAGGACAG No data
Right 1179190358 21:39117633-39117655 TAGGACAGAACCGCCAAGTCAGG No data
1179190355_1179190362 9 Left 1179190355 21:39117618-39117640 CCACCCTGCTGCTGTTAGGACAG No data
Right 1179190362 21:39117650-39117672 GTCAGGAGCAACAGATAAAAGGG No data
1179190355_1179190363 24 Left 1179190355 21:39117618-39117640 CCACCCTGCTGCTGTTAGGACAG No data
Right 1179190363 21:39117665-39117687 TAAAAGGGCTTCCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179190355 Original CRISPR CTGTCCTAACAGCAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr