ID: 1179194309

View in Genome Browser
Species Human (GRCh38)
Location 21:39151287-39151309
Sequence CCAACTGACGCTCCCACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179194309_1179194316 21 Left 1179194309 21:39151287-39151309 CCTACTGTGGGAGCGTCAGTTGG No data
Right 1179194316 21:39151331-39151353 GGCTTTCAGCGGTAGGTCCCAGG No data
1179194309_1179194312 0 Left 1179194309 21:39151287-39151309 CCTACTGTGGGAGCGTCAGTTGG No data
Right 1179194312 21:39151310-39151332 TAGGAGAGAGTTCCAGTTAGAGG No data
1179194309_1179194313 10 Left 1179194309 21:39151287-39151309 CCTACTGTGGGAGCGTCAGTTGG No data
Right 1179194313 21:39151320-39151342 TTCCAGTTAGAGGCTTTCAGCGG No data
1179194309_1179194315 14 Left 1179194309 21:39151287-39151309 CCTACTGTGGGAGCGTCAGTTGG No data
Right 1179194315 21:39151324-39151346 AGTTAGAGGCTTTCAGCGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179194309 Original CRISPR CCAACTGACGCTCCCACAGT AGG (reversed) Intergenic
No off target data available for this crispr