ID: 1179197950

View in Genome Browser
Species Human (GRCh38)
Location 21:39183417-39183439
Sequence AGCGCCGCGGGACCGCACGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179197947_1179197950 -5 Left 1179197947 21:39183399-39183421 CCGGCTGGACACAACTGCAGCGC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197941_1179197950 12 Left 1179197941 21:39183382-39183404 CCATAGCCGCCCCGTGACCGGCT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197944_1179197950 3 Left 1179197944 21:39183391-39183413 CCCCGTGACCGGCTGGACACAAC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197938_1179197950 28 Left 1179197938 21:39183366-39183388 CCGAAGAACGTGGCCGCCATAGC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197945_1179197950 2 Left 1179197945 21:39183392-39183414 CCCGTGACCGGCTGGACACAACT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197939_1179197950 15 Left 1179197939 21:39183379-39183401 CCGCCATAGCCGCCCCGTGACCG 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197946_1179197950 1 Left 1179197946 21:39183393-39183415 CCGTGACCGGCTGGACACAACTG 0: 1
1: 0
2: 0
3: 16
4: 320
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61
1179197943_1179197950 6 Left 1179197943 21:39183388-39183410 CCGCCCCGTGACCGGCTGGACAC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1179197950 21:39183417-39183439 AGCGCCGCGGGACCGCACGCCGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179197950 Original CRISPR AGCGCCGCGGGACCGCACGC CGG Exonic