ID: 1179198043

View in Genome Browser
Species Human (GRCh38)
Location 21:39183826-39183848
Sequence TGAGCCCTGCGGGCGCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179198031_1179198043 21 Left 1179198031 21:39183782-39183804 CCTCAGCCACCGCGTCCGGCCCC 0: 1
1: 1
2: 44
3: 239
4: 1306
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198037_1179198043 1 Left 1179198037 21:39183802-39183824 CCCCAAAGGCTTTCATTCGCAGC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198034_1179198043 12 Left 1179198034 21:39183791-39183813 CCGCGTCCGGCCCCCAAAGGCTT 0: 1
1: 0
2: 1
3: 28
4: 265
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198036_1179198043 2 Left 1179198036 21:39183801-39183823 CCCCCAAAGGCTTTCATTCGCAG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198035_1179198043 6 Left 1179198035 21:39183797-39183819 CCGGCCCCCAAAGGCTTTCATTC 0: 1
1: 1
2: 0
3: 18
4: 274
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198032_1179198043 15 Left 1179198032 21:39183788-39183810 CCACCGCGTCCGGCCCCCAAAGG 0: 1
1: 1
2: 15
3: 152
4: 1207
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198038_1179198043 0 Left 1179198038 21:39183803-39183825 CCCAAAGGCTTTCATTCGCAGCT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173
1179198039_1179198043 -1 Left 1179198039 21:39183804-39183826 CCAAAGGCTTTCATTCGCAGCTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179198043 Original CRISPR TGAGCCCTGCGGGCGCCAGG AGG Exonic
900095283 1:937697-937719 TGGGCCCGGCGGGCGGCGGGGGG - Intronic
900345732 1:2209516-2209538 TGGGCCCTGAGGGCGCTGGGTGG - Intronic
900373582 1:2343405-2343427 CCAGCCCTGCCGGGGCCAGGCGG + Intronic
900490685 1:2947507-2947529 TGAGCCCTGAGGGCACCGGCAGG - Intergenic
900541300 1:3204314-3204336 GGAGCCCTGCGGGGAGCAGGCGG - Intronic
900718510 1:4160275-4160297 AGAGCCCTGCCTGCGCCATGGGG - Intergenic
901193442 1:7426073-7426095 GGAGCCCTGCAGATGCCAGGAGG - Intronic
902315394 1:15614913-15614935 TGAGAACTGCTGGCTCCAGGTGG + Intergenic
903897790 1:26620409-26620431 AGAGCACTGTGGGCGGCAGGGGG + Intergenic
904565651 1:31426727-31426749 TGAGCCCAGCGGCTGCCACGAGG + Exonic
906480562 1:46196814-46196836 TGCGCCGTGGGGGCTCCAGGCGG + Exonic
914674657 1:149899509-149899531 TGAGCCCTCAGGGCACCACGTGG + Exonic
916588386 1:166166901-166166923 TCGGCCCGGGGGGCGCCAGGAGG + Exonic
916674932 1:167057411-167057433 TGATCCCTGCTGCCACCAGGTGG + Intronic
917241903 1:172957553-172957575 TGAGTCCTGCTGGGGACAGGAGG + Intergenic
919748290 1:201021974-201021996 GGAGCCCTGCAGGTGCCTGGTGG - Intronic
919768592 1:201142897-201142919 TGAGCCCTGCACTCCCCAGGTGG - Intronic
1065100452 10:22325822-22325844 TGAGCGCGGCGGACGCCCGGGGG - Intronic
1066080969 10:31929454-31929476 CGAGCCCTGCGGGGGCCACAGGG + Intergenic
1067057703 10:43061832-43061854 TGAGCTCTGGGGGCTCCATGAGG + Intergenic
1070565811 10:77603176-77603198 GGAGCCCTGAGGGCACCAGGGGG - Intronic
1070792300 10:79196683-79196705 TGAGCCCTGTGGTCGCCAGCTGG + Intronic
1071997632 10:91163192-91163214 CGAGCCCGGCGGGCGGGAGGGGG + Intronic
1075520827 10:123142719-123142741 GGTGCCCCGCGGGCGCAAGGGGG - Intergenic
1077045981 11:545332-545354 TGAGCCGTGCGGGGGCCAGAAGG - Intronic
1077085581 11:748231-748253 TGAGCCCTGCGGTGCCCAGTGGG + Intronic
1077303631 11:1858244-1858266 CAAGACCTGCGGGCACCAGGAGG + Intronic
1081605926 11:44526935-44526957 AGGGCCCTGGGGGCGACAGGTGG + Intergenic
1083324538 11:61866639-61866661 TGGGCCCTGCAGGCTGCAGGAGG + Exonic
1084072324 11:66744600-66744622 TGAGCGCCGCGGGTGCCAGTGGG - Intronic
1084493605 11:69491252-69491274 TGAGCTTTGCAGGCTCCAGGGGG + Intergenic
1085504102 11:77046222-77046244 TGCGGCCCGCGGCCGCCAGGGGG + Intergenic
1089540647 11:119187461-119187483 TGAGCCCAGAGGGTGCGAGGGGG + Intronic
1089578782 11:119468551-119468573 TGAGTCCTCCTGGCCCCAGGGGG + Intergenic
1089877591 11:121740504-121740526 GGAGCCCTGAGGTCCCCAGGTGG + Intergenic
1091550148 12:1530571-1530593 GGAGCCCTCCGGGCGGCAGGAGG + Intronic
1091558844 12:1594946-1594968 TTAACCCTGTGGGCGCCACGGGG + Intronic
1101371699 12:104137522-104137544 TCAGCCCTGCGAGTGCCAGGAGG + Intronic
1102469817 12:113153360-113153382 GGAGCCCTGCGCGCGCCTGCTGG + Exonic
1103597893 12:122035205-122035227 AGAGGCCTGGGGGCTCCAGGAGG + Intronic
1103600986 12:122054480-122054502 TGCGCACTGCGGCCGCCAGGGGG + Intronic
1104690113 12:130819147-130819169 TGGGCACGGCGGCCGCCAGGTGG - Intronic
1104823655 12:131693428-131693450 TGAGCCCGGCAGGAGGCAGGAGG - Intergenic
1104975715 12:132551113-132551135 AGAGCCCTGCAGGCTCCAGATGG + Intronic
1108212930 13:48156686-48156708 TGAGCCCTGGGGGAGCAGGGTGG + Intergenic
1112576717 13:100642783-100642805 TGGGCCCTGTGGACACCAGGTGG + Intronic
1113456955 13:110456166-110456188 TGAGCCCTGCAGGAGCTAGTGGG + Intronic
1113495554 13:110725630-110725652 GGAGGCCTCCGGGTGCCAGGCGG - Intergenic
1114483190 14:23047899-23047921 TGAGCCCCACGGGGTCCAGGCGG - Exonic
1118992595 14:70809582-70809604 CCAGCCCTGCGGACCCCAGGGGG + Intergenic
1119290456 14:73491311-73491333 GCAGCTCTGCGGGCCCCAGGTGG - Exonic
1120730213 14:87993043-87993065 TGTGCGCTGCTGGCGCCCGGCGG - Exonic
1122058583 14:99121721-99121743 TGAGCCCTGCGGATACCTGGGGG - Intergenic
1122582374 14:102778291-102778313 TCTTCCCCGCGGGCGCCAGGCGG + Intronic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG + Intergenic
1124392192 15:29269491-29269513 TGGGCCCGGCGGGCGCCCTGAGG + Exonic
1124628951 15:31326535-31326557 CGGGCCCTGCGCGCGCCAGTGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128350397 15:66884807-66884829 TGGGCCCTGCGTGCTCAAGGTGG - Intergenic
1128536107 15:68491835-68491857 TGTGTCCTGTGGGGGCCAGGGGG + Intergenic
1128894814 15:71363071-71363093 TGTGGCCTGCGGGCGGCAGGTGG + Intronic
1130919063 15:88328933-88328955 TGAGCCATGTGGGCACCTGGAGG + Intergenic
1131463484 15:92636698-92636720 TGACCCCTGAGAGGGCCAGGGGG + Intronic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132570524 16:642103-642125 TGGGACCTGCGGGCACCGGGGGG - Exonic
1132745469 16:1434478-1434500 AGGGCCCTGCGGAGGCCAGGAGG - Exonic
1132863325 16:2082060-2082082 CCAGCACTGCGGGCTCCAGGAGG + Intronic
1134508170 16:14824633-14824655 TGAGCCCTGCGCGGGGCAGGGGG - Intronic
1134695868 16:16223398-16223420 TGAGCCCTGCGCGGGGCAGGGGG - Exonic
1134975958 16:18571290-18571312 TGAGCCCTGCGCGGGGCAGGGGG + Intergenic
1135546734 16:23371657-23371679 GGACCCCTGCAGGTGCCAGGGGG - Intronic
1137582246 16:49640591-49640613 TCAGCGCTGCGGGGGCCAGGGGG - Intronic
1137716252 16:50600074-50600096 TGACCACTGTGGGGGCCAGGGGG + Intronic
1137815206 16:51392124-51392146 TGGGCCGTGGGGGCTCCAGGGGG - Intergenic
1138532312 16:57641094-57641116 TGAAGCCTGCGGGAGCCTGGAGG + Intronic
1139407079 16:66727613-66727635 TGAGCCCTGCAGGGGCTGGGTGG - Intronic
1141000183 16:80300484-80300506 TGGCCCCTGCTGGAGCCAGGTGG - Intergenic
1141063265 16:80894612-80894634 TGATCCCTGCAGGGCCCAGGTGG - Intergenic
1142145494 16:88491276-88491298 GGAGCTCTGCGGGCCCGAGGGGG - Intronic
1142373247 16:89694483-89694505 GGAGGCCTGCGGGGCCCAGGAGG + Intronic
1142638296 17:1271016-1271038 TGGGCCCTGCAGGCGGCGGGGGG - Exonic
1143498213 17:7324355-7324377 TGCCCGCTGCGGCCGCCAGGCGG + Intronic
1144839643 17:18177986-18178008 TGTGCACTGTGGGAGCCAGGCGG + Intronic
1146127197 17:30238725-30238747 GGAGCCCTGAGTGCGGCAGGAGG + Intergenic
1147725995 17:42566609-42566631 TCAGCCTTCCGCGCGCCAGGCGG + Intergenic
1151556627 17:74850044-74850066 TGAGCTCTGAGGGCCCCAGAGGG - Intronic
1151960624 17:77403573-77403595 CGATCCCTGCTGGGGCCAGGGGG - Intronic
1152661177 17:81542931-81542953 TGAGTGCTGGGGGCACCAGGGGG - Intronic
1152724229 17:81937265-81937287 TCAGCGCTGCGGCCGCCACGCGG + Intronic
1153044059 18:839500-839522 GGAGCTCTGCGGGCGCCACCTGG + Intergenic
1155216506 18:23648000-23648022 TGAGGCCTGAAGGTGCCAGGGGG + Intronic
1156544342 18:37948676-37948698 TGAGCCCAGCTGGCGCCACATGG - Intergenic
1157585082 18:48795885-48795907 TGAGAGCTGTGGGTGCCAGGTGG - Intronic
1160506676 18:79431103-79431125 TGGGCCCTGCGGGTGCCTGCTGG - Intronic
1160947969 19:1652276-1652298 TGAGCCCGGCGGGGGGCGGGGGG - Intronic
1161740649 19:6019013-6019035 AGGGCCCTGCAGGCGGCAGGAGG - Intronic
1163782699 19:19258637-19258659 GGAGCCCTGCGGCGGCCTGGGGG - Exonic
1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG + Intergenic
1166339178 19:42127330-42127352 TGAGTCCGGGGGTCGCCAGGTGG - Intronic
1166662590 19:44657100-44657122 TGAGCTCTGCGGGTGCCTAGGGG + Intronic
1167001158 19:46746365-46746387 TGAGCCGAGCGGACGGCAGGAGG + Exonic
1168534547 19:57158163-57158185 TGAGTCCTGTGGGCACCTGGGGG + Intronic
927694596 2:25231243-25231265 AGAGCCCCGCGGGAGCAAGGAGG + Exonic
931253043 2:60550515-60550537 TGAGCCATTCGGTCGCTAGGAGG - Intronic
932430533 2:71671456-71671478 TGAGCCCTGGGGGTGCCACGGGG - Intronic
936075089 2:109396726-109396748 TGAGGCCCGCAGGTGCCAGGAGG - Intronic
936518588 2:113197990-113198012 TGAGGCTTGTGGGCCCCAGGGGG + Intronic
937047263 2:118858492-118858514 GTCGCCCTGCGGGCTCCAGGTGG + Intergenic
938305594 2:130252249-130252271 TGAGCCCAGCGGGCTCCAGCCGG + Intergenic
943179354 2:184524092-184524114 GGAGCCCTGGGGGCTCCCGGAGG - Intergenic
948499320 2:238380282-238380304 TGAGCCCTGCAGGAGCCACGTGG + Intronic
948794227 2:240393946-240393968 TGAGCCCTGTGGGTGCCGGGGGG - Intergenic
948844181 2:240675360-240675382 AGAGCCCTGTGGGGTCCAGGCGG - Intergenic
948849679 2:240699519-240699541 AGAGCCCTGTGGGGTCCAGGCGG + Intergenic
949004489 2:241637505-241637527 GGCGCCCTGCGGGCGGCATGGGG - Intronic
1169345376 20:4824154-4824176 TGTGTACTGGGGGCGCCAGGAGG - Intergenic
1174157776 20:48527978-48528000 TGAGGCCTGCGGGACCCAGGCGG - Intergenic
1175388597 20:58612486-58612508 TGACCCCTGCGGGCCTGAGGGGG - Intergenic
1175630265 20:60529637-60529659 TGAGCCCTGGGGTCTCCCGGAGG + Intergenic
1175870351 20:62206410-62206432 TGACACCTGCGGTCCCCAGGTGG - Intergenic
1175914466 20:62419268-62419290 TGGGGCCTGCGGGTGGCAGGTGG + Intronic
1175939735 20:62532486-62532508 TGAGCCCTGCAGGCTGAAGGCGG - Intergenic
1176135651 20:63520981-63521003 CGAGCCCAGCGCTCGCCAGGCGG - Intronic
1176157344 20:63628147-63628169 TGAGCCCTGGGGGCTGGAGGAGG - Intergenic
1178405404 21:32319193-32319215 TGAGTCCTGCCCCCGCCAGGGGG - Intronic
1178504127 21:33149448-33149470 TGAGGCCTGCGAGTGGCAGGTGG - Intergenic
1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG + Exonic
1180026447 21:45165050-45165072 TGAGGCCTGGGCGCTCCAGGGGG - Intronic
1182094115 22:27614628-27614650 GGAGCCCAGCGGGCTCTAGGAGG + Intergenic
1182791321 22:32955434-32955456 TGAGCCATGCGGACACCTGGGGG + Intronic
1183629176 22:39022761-39022783 TGAGCCCCGAGGACTCCAGGAGG + Intronic
1184059684 22:42074349-42074371 TGGGCCCGGCGGGCTCCGGGAGG + Intronic
1184754571 22:46508608-46508630 TGAGCCCTGGACGCCCCAGGCGG - Intronic
1185205634 22:49536432-49536454 TGCCCCCTGCGGACGCAAGGAGG + Intronic
1185254825 22:49826523-49826545 AGAGCCCTGCGGGCCACAGGCGG + Intronic
950710616 3:14810724-14810746 GGGGCCGGGCGGGCGCCAGGGGG + Intergenic
953884107 3:46705959-46705981 TGAGCCCTCTGGGGGGCAGGGGG - Intronic
954246932 3:49339682-49339704 CGGGCCCGGCGGGGGCCAGGAGG - Intronic
956129273 3:66038918-66038940 TGCGCCCCGCGGCCGCCAGCCGG + Intergenic
957792595 3:84959494-84959516 TGGGTCCGGCGGGCGCCGGGAGG + Intronic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
961591849 3:127987073-127987095 TGACCTCTGCTGGAGCCAGGAGG + Exonic
962804356 3:138916134-138916156 TGTGGGCTGCGGCCGCCAGGTGG - Intergenic
966840772 3:184085439-184085461 TGAGTCCTGTGGGAACCAGGAGG - Intergenic
967991175 3:195132007-195132029 TGAGACTTGGGGGAGCCAGGCGG + Intronic
968088079 3:195883133-195883155 TGAGTACTGCGGGCGGGAGGGGG - Intronic
980984732 4:139684403-139684425 TGAGCCCTGATGGCATCAGGAGG + Intronic
985774249 5:1832537-1832559 TGAGCCCTGGGCGTGCCCGGGGG - Intergenic
985803910 5:2025214-2025236 GGAGCACAGCGGGAGCCAGGGGG + Intergenic
992391982 5:76337969-76337991 TGAGCCCTGGTGGCTCCAAGGGG + Intronic
994353971 5:98774383-98774405 TGCGCCCGGCGGCCGCCCGGTGG - Intronic
999272045 5:150302422-150302444 TGCGCCCTGGGCGCGCGAGGTGG - Exonic
1001531170 5:172462925-172462947 TGAGCCGAGCAGGCGCCTGGGGG + Intergenic
1001958970 5:175868448-175868470 TGAGCCCTGGGGGCAGGAGGAGG - Intronic
1003028420 6:2579267-2579289 GGAGCCCTCCGGGCCCCAGTGGG + Intergenic
1003947344 6:11087592-11087614 TGAGAAGTGCGGGCGCAAGGCGG + Intergenic
1005882400 6:30071369-30071391 TGTGCCCTGCGGGGGCCGTGTGG - Exonic
1012465772 6:99515234-99515256 TGATCCCTGGGGGCGCCGGGCGG - Exonic
1018046320 6:159969290-159969312 AGAGCGCTGCGGGCGGCGGGCGG - Exonic
1018432056 6:163730368-163730390 TCAGCCCTGTGGGAGCCTGGTGG + Intergenic
1018997663 6:168722609-168722631 TGACCCCTGTGGGGTCCAGGGGG - Intergenic
1019495815 7:1340164-1340186 CCAGCCCTGCGGGTGCCAGCAGG + Intergenic
1021159885 7:17259808-17259830 TGTGCCCTGAGGGAGACAGGTGG - Intergenic
1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG + Intronic
1024201970 7:47117218-47117240 TAAGGCCTGGGGGGGCCAGGTGG - Intergenic
1026739311 7:72968978-72969000 TGAACCCTGCTGGTGGCAGGTGG + Intronic
1026790336 7:73327593-73327615 TGAACCCTGCTGGTGGCAGGTGG + Intronic
1027104420 7:75396095-75396117 TGAACCCTGCTGGTGGCAGGTGG - Intronic
1027233988 7:76287104-76287126 AGATCCCTGAGGGCCCCAGGAGG - Exonic
1027390348 7:77697106-77697128 CGGGCCCCGTGGGCGCCAGGGGG - Intronic
1033049284 7:137989499-137989521 GGAGCCCTGGGGGCACCAGAAGG - Intronic
1034204646 7:149304870-149304892 TGAACGCTGTGGGCCCCAGGAGG + Intergenic
1034492916 7:151403812-151403834 TGAGCCCTCCTGGCGGCAGCAGG - Intronic
1036811197 8:11868342-11868364 GGAGCCCTGCGGGCCCTGGGTGG + Intronic
1038954111 8:32448738-32448760 GGACCCCTGGGGGCGTCAGGAGG - Intronic
1042696402 8:71558281-71558303 TGTTCCCGGCGGGCGGCAGGGGG - Intronic
1048555787 8:135474840-135474862 TGAGCCCAGTGGGAGCCACGCGG - Intronic
1048717834 8:137287502-137287524 TGCACCCTGCTGGCGCCAAGTGG - Intergenic
1049405364 8:142449859-142449881 GGAGCCCCCCGGGCGCCCGGAGG - Exonic
1049957512 9:707226-707248 GGAGCGCGGCGGGCGCCACGTGG + Intronic
1054143692 9:61547867-61547889 TGCCCCCTCCGGGCACCAGGAGG + Intergenic
1056755930 9:89382115-89382137 TGGGCACTGCTGGTGCCAGGTGG - Intronic
1057716756 9:97501828-97501850 GGAGCCCCGCGAGCGCGAGGGGG - Intronic
1059407089 9:114108073-114108095 TGCGCCCTGCGGGGCCCAGCCGG - Intergenic
1060407338 9:123379406-123379428 TCAGCCCTGCGGGGGCCATGGGG - Intronic
1060794329 9:126504095-126504117 TGAGACGTGCTGGCCCCAGGAGG + Exonic
1060955143 9:127633405-127633427 TGACCCTTGCGGACCCCAGGAGG + Intronic
1061665560 9:132159267-132159289 TCAGCCTTGCGGGGACCAGGTGG - Intergenic
1061666165 9:132162027-132162049 GGAGCCCTCCGGCCGCCGGGGGG - Exonic
1062073588 9:134572418-134572440 TGAGCCCTCCGTGCGACAGCGGG + Intergenic
1062629677 9:137458235-137458257 CCAGCCCTGGGGGAGCCAGGAGG + Intronic
1189331382 X:40146716-40146738 TAGGCCCTGCGGGCGCCTCGGGG + Intronic
1200065557 X:153502729-153502751 TGACCCCTGGGGTCACCAGGAGG - Intronic
1200077193 X:153557029-153557051 TGAGCTGGGCGGGCACCAGGTGG - Intronic