ID: 1179200844

View in Genome Browser
Species Human (GRCh38)
Location 21:39219127-39219149
Sequence AAAAATAAGGAGAAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1388
Summary {0: 1, 1: 1, 2: 8, 3: 123, 4: 1255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179200844 Original CRISPR AAAAATAAGGAGAAGCAGGC AGG Intronic
900195992 1:1375684-1375706 AAAAAAAATAAGACGCAGGCTGG + Intergenic
901122261 1:6905489-6905511 TAAAGAAAGGAGGAGCAGGCCGG - Intronic
901403855 1:9032876-9032898 AAAAATAAGTAGACATAGGCCGG - Intergenic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901692889 1:10985245-10985267 AAAGAAAAAGAGAAACAGGCTGG - Intergenic
901865806 1:12106013-12106035 AAACATGAAGAGAAGAAGGCAGG - Intronic
902116618 1:14126641-14126663 AAAAATAAGGACAATCAGAGAGG + Intergenic
902139525 1:14341187-14341209 AAAAATAAGGAAAATCAGCTGGG - Intergenic
902267008 1:15274690-15274712 AATAATGAGGAGGAGCAGGAGGG + Intronic
902309680 1:15572344-15572366 AAAAAAAAAAAAAAGCAGGCCGG - Exonic
902350977 1:15854095-15854117 AAAAATAAAAGCAAGCAGGCCGG - Intronic
902701948 1:18178672-18178694 AAAAGGAAGGAGAAGCTGGCAGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902959244 1:19950651-19950673 AAAAAGTTTGAGAAGCAGGCTGG - Intergenic
903279649 1:22243428-22243450 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
903437792 1:23365095-23365117 AAAAATAAAAAGAGGCAGGCCGG + Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903905538 1:26683359-26683381 GAAAAAAGGAAGAAGCAGGCTGG - Intergenic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904215722 1:28917166-28917188 AAAAATAAGGAGAATAAAGGTGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905055556 1:35090607-35090629 GATAGTGAGGAGAAGCAGGCAGG + Intronic
905135326 1:35794867-35794889 AAAAAAAAGGAGAGGCAGCGGGG - Intergenic
905531601 1:38683796-38683818 AAGAATAAGAAGAAGCTGGGGGG - Intergenic
905657460 1:39693958-39693980 AAAAATAAGGAGGCTGAGGCAGG + Intronic
905977348 1:42186212-42186234 TAAAACAAGAGGAAGCAGGCTGG + Intronic
906339498 1:44966452-44966474 AAAAAGAAGAAGAAGAAGCCTGG + Intronic
906411208 1:45580982-45581004 AAAAATAAGGCCAGGCAGGGTGG - Intergenic
906494042 1:46290902-46290924 AAAAAAAACTAGAAACAGGCCGG - Intronic
907295845 1:53453552-53453574 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
907683057 1:56582008-56582030 ACAGATAAGGAAAAGCAGACAGG - Intronic
907982533 1:59498222-59498244 ACAAATGAGGAGAAGTAGGCTGG + Intronic
908035443 1:60046429-60046451 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
908104012 1:60822441-60822463 GAAAAGAAGGTGAAGCAGTCAGG + Intergenic
908194958 1:61739425-61739447 TAAAGTAAGAAGAGGCAGGCTGG + Intergenic
908399308 1:63755541-63755563 ATAAAAAAGGAAGAGCAGGCTGG + Intergenic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
908472972 1:64462442-64462464 AAAAATAAGCAGAATTAGCCAGG - Intergenic
908493724 1:64673001-64673023 AAAAATGAAGGGAAGCTGGCAGG - Intronic
908948602 1:69530489-69530511 TCCAATAAGGAGAAGCAGTCAGG - Intergenic
909184058 1:72462645-72462667 AAAATGAAGGAGAAGAACGCAGG + Intergenic
909192968 1:72577546-72577568 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
909469526 1:76011634-76011656 AAAAAGAAAAAGAAACAGGCCGG + Intergenic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909913224 1:81285913-81285935 AAAAAGAAGGAAAAGAAGCCTGG - Intergenic
910125125 1:83832196-83832218 AAAAATGAGGAAAAGGATGCAGG + Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910198289 1:84668807-84668829 AAAAATAAGGAAAAGTAAACGGG + Intronic
910663746 1:89701887-89701909 AAAACTAAGCAGTAGCAGCCAGG + Intronic
910756965 1:90704495-90704517 AAAAATCAGGAGGACAAGGCAGG + Intergenic
910774060 1:90857215-90857237 AAAAAAAAGAAGAAGCTGGGAGG + Intergenic
910885152 1:91956321-91956343 ACAACTCAGGAAAAGCAGGCAGG - Intronic
911134147 1:94421204-94421226 AAAAATAAGGGGTGACAGGCAGG - Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911480912 1:98439355-98439377 AAAAGTGAAGAGAAGAAGGCAGG + Intergenic
911552015 1:99294103-99294125 AAAAAAAAGGAGAAATAAGCTGG + Intronic
912089625 1:106055200-106055222 AAGAAAATGGATAAGCAGGCAGG + Intergenic
912142251 1:106744930-106744952 AAAATCAAGGAGAAGTAGACTGG + Intergenic
912327444 1:108781441-108781463 AAAGATAAGGGGAATCAGTCAGG + Intronic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912521982 1:110251911-110251933 TGAAGTAAGGAGAGGCAGGCTGG - Intronic
912791587 1:112657258-112657280 ACAAAGAAGGAGAAATAGGCCGG - Intronic
913141573 1:115946562-115946584 AAAAATAAGACAAAACAGGCTGG + Intergenic
913424549 1:118712993-118713015 AAAATGAAGGAGCTGCAGGCTGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
913978871 1:143489521-143489543 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914073278 1:144315170-144315192 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
914105876 1:144651190-144651212 AAAAAAAAGGAGCAGCAGCCAGG + Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914682486 1:149948664-149948686 GAAAATCAGGATAATCAGGCCGG - Intronic
914687064 1:149989743-149989765 AAAAAGAAGAAGAAGAAGGTGGG + Intronic
914708236 1:150189084-150189106 AAAAATAAGAATAATCGGGCCGG + Intergenic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
914840973 1:151248377-151248399 AAAAAAAAGAAGAAGAAAGCTGG - Intronic
914929228 1:151915598-151915620 AAAAGGCTGGAGAAGCAGGCTGG + Intergenic
915125432 1:153660317-153660339 AAAAAAAAGGCCAGGCAGGCCGG - Intronic
915254758 1:154618811-154618833 AAAAACACCAAGAAGCAGGCCGG + Intronic
915507444 1:156366795-156366817 GAAAACAAGGAGGAGTAGGCTGG - Intronic
915614753 1:157028868-157028890 AAAGATATGGAGAAACTGGCTGG + Intronic
915837286 1:159187987-159188009 ACAAATAGAGAGAAGTAGGCAGG - Intronic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916259738 1:162829600-162829622 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916800925 1:168215817-168215839 AAAAAGAAAAAGAAGCAGGCTGG + Intergenic
916911734 1:169356324-169356346 AAAAAGAAGGTGAAGCTGGTAGG + Intronic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917433843 1:174999540-174999562 AAAAATGGGGAGGAGCAGCCTGG - Intronic
917539402 1:175898508-175898530 AGAAAAAAGAAGAAGCAGCCAGG + Intergenic
917873310 1:179261742-179261764 AAAAATGTGTGGAAGCAGGCTGG - Intergenic
917983895 1:180294993-180295015 AAAAAAGAGAAGAAACAGGCTGG - Intronic
917997838 1:180459956-180459978 AAAAAAAAAAAGAAGCAGTCTGG - Intronic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918662389 1:187105989-187106011 AGAAATAGGGAGAAAAAGGCTGG + Intergenic
918866240 1:189904104-189904126 GAAAATAATGAGAACAAGGCCGG - Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919718489 1:200806429-200806451 AAAAATGTGGAGAAACAGGCAGG + Intronic
919843682 1:201627571-201627593 AAAAATAAGAATAGGCAGACGGG - Intronic
920670220 1:207998446-207998468 AAAAATAAGAAGAATCAGCATGG - Intergenic
920850482 1:209624963-209624985 AAAAAGAAGGAAAAGAAGGAAGG + Intronic
920916595 1:210262578-210262600 AAAAATGAGGAGAAGGAAGGAGG - Intergenic
921009787 1:211130137-211130159 GAATATAAAGAGAAACAGGCTGG + Intronic
921038794 1:211409014-211409036 AAAAATAAAGAGAAGAAGTCTGG + Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921279102 1:213548364-213548386 AACTATAAAGAAAAGCAGGCTGG + Intergenic
921458055 1:215395410-215395432 AAAAATGAGGAGGAGTTGGCTGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
921851501 1:219936817-219936839 AAATATAAGGAAAACCAGGAGGG - Intronic
922503623 1:226114249-226114271 AAAAATAAAAACAAGCAGGCTGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922985480 1:229863057-229863079 AAAAAGAAGGAGATTCTGGCTGG - Intergenic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
923489007 1:234466565-234466587 AAAAAGAAGAAGAAGAAGCCAGG + Intronic
923589204 1:235303559-235303581 AAAAAAAACGAGAAACAGCCAGG + Intronic
923694430 1:236233313-236233335 AAAAAAAAAAAGAAGAAGGCTGG + Intronic
924457120 1:244227846-244227868 AAGAATAGGGAGACTCAGGCTGG - Intergenic
924735504 1:246752073-246752095 AAAAAAAAGGAGAATTAGCCGGG - Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063917880 10:10902959-10902981 GAAGATAAGGAGAAGAAGGGAGG + Intergenic
1064210589 10:13357596-13357618 AAAAAGAAAGAAAAGTAGGCCGG - Intergenic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1064686228 10:17864958-17864980 AAATATATAGAGAGGCAGGCAGG - Intronic
1064695530 10:17961457-17961479 AACAGAAAGGAAAAGCAGGCAGG - Intronic
1065036301 10:21642359-21642381 AAAAATACGAAGAAGTAGCCGGG + Intronic
1065062933 10:21926246-21926268 AAAAAAAAGGAAAGGCTGGCTGG - Intronic
1065350748 10:24793692-24793714 AAAAATAAAAAGAAGCATACTGG + Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066072432 10:31833341-31833363 AAAAAAAAGCAGAGGCAGGAAGG + Intronic
1066176205 10:32909538-32909560 AATGATAAGGAGACACAGGCTGG + Intronic
1067009167 10:42693288-42693310 AAATTTAAAGAAAAGCAGGCTGG - Intergenic
1067189329 10:44056594-44056616 ACAAATAAAATGAAGCAGGCAGG + Intergenic
1067253420 10:44609808-44609830 AAAAACAAGCAGAAGCGGGTTGG + Intergenic
1067460634 10:46455621-46455643 AAAAAAAAGGAAAATCAGCCTGG + Intergenic
1067513826 10:46919468-46919490 AAAAAGAAGGAGAAGAAGCATGG - Intronic
1067626558 10:47928982-47929004 AAAAAAAAGGAAAACCAGCCTGG - Intergenic
1067648428 10:48132366-48132388 AAAAAGAAGGAGAAGAAGCATGG + Intergenic
1067924168 10:50491049-50491071 AAAAAAAAGCAGCAGCAGCCAGG + Intronic
1068041166 10:51825953-51825975 AGAAGAAAGGAGAAGCAGGTGGG + Intronic
1068451928 10:57201701-57201723 AAAAAAAAGCAGAAAAAGGCCGG - Intergenic
1068888659 10:62125475-62125497 AAAAAAAAGTATAAGCAGCCGGG + Intergenic
1069389409 10:67917387-67917409 AAAACTAAGGGGATCCAGGCAGG - Exonic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069470752 10:68687197-68687219 ATAAAAAAGGATAAGTAGGCCGG - Intronic
1069542464 10:69305556-69305578 AAAAAGAAAAAGAAGAAGGCTGG + Intronic
1069595001 10:69664768-69664790 AAAAATCAGGAGACCTAGGCTGG + Intergenic
1069786893 10:70994225-70994247 AAAGATTAGGAAAAGCAGACTGG + Intergenic
1069844303 10:71360120-71360142 AAAAAAAAGAAGAAGAAGACAGG - Intronic
1069905757 10:71731137-71731159 AAAATGAAGGGGAAGCATGCCGG + Intronic
1069969981 10:72159045-72159067 AGAAATCAGGAGAAGAAGGTTGG + Intronic
1070178202 10:73990393-73990415 AAAAATAATGTGAACCCGGCCGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070336619 10:75461473-75461495 AGAAAACAGCAGAAGCAGGCAGG - Intronic
1070397384 10:76023322-76023344 AAAGATGAAGAAAAGCAGGCGGG + Intronic
1071214778 10:83388076-83388098 AGATATAAGTAGAAACAGGCTGG - Intergenic
1071271442 10:84011182-84011204 AAAAGGAAGGAGAAGCAACCAGG + Intergenic
1071444337 10:85731806-85731828 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1071534647 10:86418083-86418105 AAAAATAAGTTGAAAAAGGCAGG - Intergenic
1071798856 10:89035416-89035438 AAAAAATAGCAGAAGCAGGAAGG - Intergenic
1071918239 10:90320576-90320598 AAAAATAAGAATAAACAGACGGG - Intergenic
1072022756 10:91420287-91420309 AAAAAAAAAGAAAATCAGGCTGG + Intronic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072136628 10:92553125-92553147 AAGAAAAAGAAAAAGCAGGCTGG + Intronic
1072145653 10:92634277-92634299 AAAGAAAAGGAGAGGCTGGCTGG - Intronic
1072214752 10:93278860-93278882 AAAAAAAAGGATAATCAGGGAGG - Intergenic
1072253932 10:93602506-93602528 AAAAAGATGGAGAAGCAGGGGGG - Intronic
1072441424 10:95459524-95459546 GAAGAAAAGGAGGAGCAGGCGGG + Intronic
1072502308 10:96030106-96030128 AAAAATAAAAAATAGCAGGCTGG - Intronic
1072515330 10:96176084-96176106 AAAAATAATAATAACCAGGCAGG - Intronic
1072671922 10:97436725-97436747 TTATATAAGGAGAATCAGGCTGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073348758 10:102803891-102803913 AAAAAAAAGGAAAACCTGGCTGG - Intronic
1073834836 10:107429383-107429405 CCAAGTAAGGAGCAGCAGGCAGG - Intergenic
1074026503 10:109641277-109641299 AAAAATAAGGAGAAAACGGGAGG + Intergenic
1074146152 10:110718910-110718932 AAAAAGAAGTAGAATTAGGCTGG - Intronic
1074594847 10:114852807-114852829 AGAAATATAGAAAAGCAGGCTGG - Intronic
1075043308 10:119125811-119125833 AAAAATAACTAGAAGTTGGCTGG - Intronic
1075060682 10:119254756-119254778 AAAAAAATGGAAAAACAGGCCGG + Intronic
1075451023 10:122552073-122552095 AAAAAAAAAAAGAAGCAGGACGG + Intergenic
1075888091 10:125919499-125919521 CAAAAAAAGGAGCAGCAGCCAGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076431760 10:130408834-130408856 AAAAAAAAAGAAAAGCAGCCAGG + Intergenic
1076604303 10:131679241-131679263 ATAGATTAGGAGAGGCAGGCTGG + Intergenic
1077620051 11:3713419-3713441 AAAAATAAAGAGAATTTGGCTGG + Intronic
1077822068 11:5755506-5755528 GAAAAGAAGGAGAAGAAAGCTGG - Exonic
1078028367 11:7721755-7721777 AAAAATCAGGAAAATCAGACAGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078130650 11:8611559-8611581 AATAAAAATAAGAAGCAGGCTGG + Intergenic
1078245599 11:9571403-9571425 AAAAAAAAGGAGTGGCAGGAGGG + Intergenic
1078516603 11:12027976-12027998 AAAAATAATGGAAAGCAAGCGGG + Intergenic
1078574675 11:12489919-12489941 AAAAGTTAGGAGAGGCAGCCAGG + Intronic
1078984127 11:16574191-16574213 AAAAATAAGAATAAGGTGGCAGG + Intronic
1079347895 11:19668993-19669015 AAAATGAAGGACAAGCAGACAGG + Intronic
1079442541 11:20529656-20529678 TAAAATAAGGACAATTAGGCTGG - Intergenic
1080009213 11:27440660-27440682 AAAAATAAAGAGAAGCCTCCGGG - Intronic
1080062008 11:27966739-27966761 AAAAAGAAAGAGATGCAGGGTGG - Intergenic
1080455737 11:32417014-32417036 AAAAATAAAAAAAAGAAGGCAGG - Intronic
1080501924 11:32879442-32879464 AAAAAAAAAAAGCAGCAGGCTGG + Intergenic
1080613194 11:33923165-33923187 AAAAGTAAAAAGAAACAGGCAGG - Intergenic
1080665629 11:34333457-34333479 AAAATAAAGGAAAAACAGGCTGG + Intronic
1081057824 11:38431990-38432012 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1081104625 11:39049585-39049607 AAAAAGAAATAGAAACAGGCTGG - Intergenic
1081589585 11:44411911-44411933 AAAGAGAAGGTGAAACAGGCAGG + Intergenic
1082048936 11:47754216-47754238 AAAAAAAAGGAGAGACAGCCAGG + Intronic
1082720203 11:56665013-56665035 AAAAACATGGAGAATGAGGCTGG + Intergenic
1082928117 11:58572946-58572968 AAAAAGAAGGACAAATAGGCCGG + Intronic
1083188465 11:61032308-61032330 ATAAATAAAGAAAAGTAGGCTGG - Intergenic
1083422370 11:62561385-62561407 AAAAAAAAGGACAGGCAGGGTGG + Intronic
1083465844 11:62845442-62845464 GAAAAAAAAGAAAAGCAGGCTGG - Intergenic
1083466501 11:62850362-62850384 AAAAACAAAGAAAAGCAGCCAGG + Intergenic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1083626730 11:64075664-64075686 AAAAAGAAGCAGCAGCAGCCAGG - Intronic
1083630817 11:64094451-64094473 AAAAACAAAGTTAAGCAGGCTGG + Intronic
1083665795 11:64273872-64273894 AAAAAAAAAGAGAGGCAGGTAGG + Intronic
1083918710 11:65768008-65768030 AAAAAAAAGAAAAAGAAGGCCGG - Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084200075 11:67550890-67550912 CAACAGAAGGGGAAGCAGGCAGG - Intergenic
1084311409 11:68318339-68318361 AAAAAAAAAAAAAAGCAGGCCGG - Intronic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084590722 11:70088521-70088543 AAAAAAAAGAAGAAGAAGACAGG + Intronic
1084898271 11:72291745-72291767 AAAAACAATGAAAAGCAGGCCGG + Intergenic
1085183525 11:74556433-74556455 AAAAAAAAAAAAAAGCAGGCTGG + Intronic
1085887480 11:80537130-80537152 AATAAAAAGGAGAAGCCAGCTGG - Intergenic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086061644 11:82706115-82706137 TAAAATAAGGAGAAACTGGCTGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086110111 11:83190290-83190312 AAAAAAAAAAAGAAACAGGCCGG - Intergenic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086210774 11:84316485-84316507 AAAAATAATAATAAACAGGCAGG + Intronic
1086259613 11:84923429-84923451 AAAAAGAAGAAGAAGAAGGAGGG + Intronic
1086890263 11:92249483-92249505 AAAAAGAAAGAAAAGCAGGCAGG - Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1086998517 11:93388342-93388364 AAAAATAAAGATAACCAGGTAGG - Intronic
1087009020 11:93496168-93496190 GAAGAAAAGGGGAAGCAGGCAGG + Intronic
1087507303 11:99042348-99042370 AAAAAGAAGAAGAAGAAGGGAGG - Intronic
1087768496 11:102181514-102181536 AGAAATAAGGAGTAGGTGGCAGG - Intronic
1087973739 11:104517890-104517912 AAAAAAAAGGAGTAGGAAGCAGG - Intergenic
1088105654 11:106204072-106204094 AAATAAAAGGAGAATAAGGCAGG + Intergenic
1088301946 11:108367281-108367303 AAAAATGAGGGGAATGAGGCCGG - Exonic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088859513 11:113786576-113786598 AAAAAAAAGAAGAAAAAGGCCGG + Intergenic
1089470506 11:118716588-118716610 AAAAAAAGGGAGTAGAAGGCCGG - Intergenic
1089495321 11:118905523-118905545 AAAAAAAAAAAGAATCAGGCCGG + Intronic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1089722337 11:120438437-120438459 AAAAATCAGGTGAAACTGGCCGG - Intronic
1089895331 11:121925019-121925041 AAAAATAAGGAGAAATAAGGTGG - Intergenic
1089989383 11:122844518-122844540 AAAAATACTGAGAAACAGGAAGG - Intronic
1090053782 11:123403838-123403860 AAAACTAATGACAAGCAGGCCGG - Intergenic
1090161624 11:124501364-124501386 TAAAATGAGGAGAAGCATACAGG + Intergenic
1090297096 11:125598234-125598256 AGAAATGAGGAGACTCAGGCTGG + Intronic
1091265061 11:134264046-134264068 TAAAATTAGGAAAAGTAGGCTGG + Intronic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091504369 12:1051836-1051858 AGAAAACAAGAGAAGCAGGCAGG - Intronic
1091504375 12:1051924-1051946 AGAAAACAAGAGAAGCAGGCAGG - Intronic
1091504381 12:1052012-1052034 AGAAAACAAGAGAAGCAGGCAGG - Intronic
1091713301 12:2757992-2758014 AAAAACAAAGAGAAACAGGTGGG + Intergenic
1092235778 12:6808090-6808112 AAAAAAAAAAAAAAGCAGGCAGG + Intronic
1092250566 12:6893187-6893209 AACACTAAAGAAAAGCAGGCTGG + Intronic
1092366319 12:7880004-7880026 AAAAATAAGAAACAACAGGCCGG + Intronic
1092451280 12:8604932-8604954 AAAAAAAAGGAAAAAAAGGCGGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093166595 12:15810929-15810951 AAAAATAAGGAGAAATAGCCAGG - Intronic
1093304101 12:17490905-17490927 AGAAATAAGGAGAATCAGCTAGG - Intergenic
1093376963 12:18441062-18441084 AAAACTGAAGAGAAGCAGTCAGG + Intronic
1094111046 12:26863098-26863120 AAAAGTAAATAGAATCAGGCAGG - Intergenic
1094601397 12:31912072-31912094 AAAAAAAAGAAGAGACAGGCCGG + Intergenic
1095201850 12:39393916-39393938 AAATATAAATAGAAGTAGGCGGG + Intronic
1095475292 12:42580970-42580992 AAAAGGAAAGAAAAGCAGGCAGG + Intronic
1095634752 12:44420027-44420049 AAAAATAAAGAAAACCAGCCAGG + Intergenic
1095660893 12:44734543-44734565 CAAAATAAGTAAAAGCAGGGGGG - Intronic
1096151901 12:49319363-49319385 CAAAAAAAGTAAAAGCAGGCTGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096643535 12:53014133-53014155 AGAAAAAAGAAAAAGCAGGCCGG + Intronic
1096682686 12:53267323-53267345 AAAAAGAAAGAAAAGAAGGCCGG - Intergenic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096866107 12:54564333-54564355 AAAAAAAAAAAAAAGCAGGCCGG + Intronic
1097001044 12:55876897-55876919 AAAAAAAAAAAAAAGCAGGCTGG + Intergenic
1097003451 12:55897955-55897977 AAAAAAAAAAAGAAGAAGGCTGG + Intergenic
1097215984 12:57413437-57413459 AAAAAAAAAAAAAAGCAGGCTGG + Intronic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1097298115 12:57989140-57989162 ATAAGCAAGGAGAGGCAGGCAGG + Intergenic
1097496637 12:60347100-60347122 AAAAGTAGGGAGAAGTAGGAGGG - Intergenic
1097515492 12:60599966-60599988 AAAAATAAAGACATGCAGACTGG + Intergenic
1097956610 12:65493348-65493370 CAAATTAAGGAGAAACAGGATGG - Intergenic
1098283169 12:68882016-68882038 AAAAAAAAAAAAAAGCAGGCCGG - Intronic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098338563 12:69428237-69428259 AAAGATAAGAAGAAGTAGGGAGG + Intergenic
1098620411 12:72590641-72590663 AAAAATAAGATTAAGAAGGCTGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098922184 12:76312867-76312889 AAAAAGAGGGAGCAGCGGGCTGG + Intergenic
1098941469 12:76541873-76541895 AAAAATAAATAAAAGTAGGCCGG + Intronic
1099201360 12:79681110-79681132 AGAAAAAAGGAGAAGAAGGGAGG + Intronic
1099373156 12:81863193-81863215 AAAAATAAGAAGGAGCATGATGG + Intergenic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099449776 12:82794929-82794951 AAAAATAAATAAAAGGAGGCCGG + Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100593910 12:96055359-96055381 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1100991659 12:100257785-100257807 AAATAAAAGGAAAACCAGGCTGG - Intronic
1101072671 12:101092657-101092679 AAAAATAAGGTAAAGCATACAGG - Intronic
1101774370 12:107780152-107780174 ATAAATAAAGAGAAGAAAGCAGG + Intergenic
1102007730 12:109599174-109599196 AAAAATAAGAAAATGCAGCCAGG + Intergenic
1102140637 12:110612122-110612144 AAAAATAACCAAAAGTAGGCCGG - Intergenic
1102158192 12:110747137-110747159 AAAAAAAAGAAGAAGAAGGTGGG + Intergenic
1102282307 12:111627977-111627999 AATAATAAGAAGAAGAAGCCAGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102876333 12:116451949-116451971 AAAAAAAAAAAAAAGCAGGCCGG - Intergenic
1102877717 12:116460715-116460737 AAAAATAAAAATAAGAAGGCTGG + Intergenic
1103047492 12:117749423-117749445 AGAAATAACGAGAGGAAGGCAGG + Intronic
1103312425 12:120021602-120021624 AAAAAAAAAGAGAATCAGCCAGG + Intronic
1103350935 12:120283120-120283142 AAAAATACGGAAAAGTAGCCGGG + Intergenic
1103359146 12:120343195-120343217 AAAAATAAGAAGAAGAAAGTAGG - Intronic
1103616328 12:122155185-122155207 AAAAAAAAAGAGAAGAAGCCAGG - Intergenic
1103750698 12:123158313-123158335 AAAAATAAGGCCAAGCATGATGG + Intronic
1103835631 12:123818241-123818263 AAAAATAAAGAGATAGAGGCTGG - Intronic
1103888041 12:124217377-124217399 AAAAAAAAAAAAAAGCAGGCAGG - Intronic
1104046020 12:125163589-125163611 AAAAACAAAAAGAAGAAGGCTGG + Intergenic
1104441138 12:128794271-128794293 AATAATGAGGAAAAGCAGGAGGG + Exonic
1104494522 12:129224609-129224631 AAAAATCAGACTAAGCAGGCAGG + Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104865779 12:131952746-131952768 AACAATAAAAAGAAACAGGCTGG - Intronic
1104930174 12:132334653-132334675 AAAAATACAGAAAAGCAGGAGGG - Intergenic
1105202441 13:18191740-18191762 AAAGATAGAGAGAAGCAGGCAGG - Intergenic
1105220462 13:18321869-18321891 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic
1105430848 13:20336091-20336113 AAAAATAAGGAGCCACAGGCAGG - Intergenic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1107068198 13:36240137-36240159 AAAAATAGTGAGAAGCAAGGTGG - Intronic
1107511302 13:41088137-41088159 AAAAAGAAGAAGAACCAGCCAGG - Intergenic
1107511317 13:41088285-41088307 AAAAAAAAAGAGTACCAGGCTGG - Intergenic
1107562842 13:41572811-41572833 AAAAAAAAAAAGAAACAGGCCGG + Intronic
1107908251 13:45081992-45082014 AAAAAAAAGGAGAGACAGCCGGG + Intergenic
1108148079 13:47500830-47500852 AGAAAGAAGGAGTAGCTGGCTGG - Intergenic
1108165034 13:47684060-47684082 AAAAAAAAGGAGAAGCACAATGG - Intergenic
1108355597 13:49626315-49626337 AAAAAAAAAAAGAAGCAGGCTGG - Intergenic
1108362491 13:49679925-49679947 AGTAATAAGGAGAGGCAGGCTGG + Intronic
1108398507 13:50014171-50014193 AAAAAAAAGGATCAGCTGGCTGG + Intronic
1108456032 13:50614624-50614646 AAAAAAAAGGAAAATCAGCCAGG + Intronic
1108632094 13:52294800-52294822 AAAAATAAAGAGATAGAGGCCGG + Intergenic
1108654606 13:52517794-52517816 AAAAATAAAGAGATAGAGGCCGG - Intergenic
1108688040 13:52837644-52837666 AGAAATAAAGAGAAGCAGCCAGG - Intergenic
1109140242 13:58705647-58705669 AAAAAGAAGGAGAGGAAGGGAGG - Intergenic
1109267316 13:60216476-60216498 AAAGAAAAGGAGAAGCAGAGAGG - Intergenic
1109741302 13:66559502-66559524 AAAAATACGGATCAGGAGGCCGG + Intronic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1110425083 13:75357863-75357885 AGAAATAAACAGAAGCAGGAGGG - Intronic
1110564167 13:76941220-76941242 AAAAAATATGAAAAGCAGGCCGG + Intergenic
1111356839 13:87117388-87117410 AAAAATCAGTATAAGCATGCTGG - Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111686860 13:91512889-91512911 AATAATAATGAGAACCAAGCTGG - Intronic
1112022157 13:95380891-95380913 GAAAAAAGGGAGAAGCTGGCAGG - Intergenic
1112489090 13:99845835-99845857 AAAACGAAGGAGAAGAAGGACGG - Intronic
1113031375 13:105997414-105997436 AAAAATACGGGGCAGCAGGTTGG - Intergenic
1113647861 13:112011640-112011662 AAAAAGAAGGAGAAGAGGCCGGG - Intergenic
1114311444 14:21471318-21471340 AAAAATCTGAAGCAGCAGGCTGG + Intronic
1114492950 14:23114560-23114582 AAAAATTTTGAGAAGGAGGCAGG - Intergenic
1114639512 14:24209960-24209982 AAAAGAAAGGAGAAGCAGTAAGG + Intronic
1114663087 14:24361591-24361613 AAAGAAAAGGAGAATCAGTCAGG - Intergenic
1115061547 14:29197090-29197112 AAAAATATGTAGAAGAAGGGAGG + Intergenic
1115576826 14:34719477-34719499 AAAAATAAAAAAAATCAGGCGGG + Intergenic
1115881507 14:37924374-37924396 AAAAAAAAAGAGAAGCATGAAGG - Intronic
1116374342 14:44179090-44179112 AAAAATAAAGAAAAGAAAGCAGG + Intergenic
1116692090 14:48121167-48121189 AAAACTAAGGAAGAGGAGGCAGG - Intergenic
1117182643 14:53207666-53207688 AAAAATAAAGATAAACAGACGGG + Intergenic
1117390946 14:55262011-55262033 AAGAATAAGGACAGGCTGGCTGG + Intergenic
1117416819 14:55504471-55504493 AAAACAAAGGGGAAGCAGGATGG - Intergenic
1117440848 14:55757623-55757645 AAAAAAAAAGAGATACAGGCAGG + Intergenic
1117551834 14:56844414-56844436 AAAAAGAAAGAAAAGCAAGCTGG + Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1117982283 14:61353632-61353654 TTAAATAATGAGAATCAGGCTGG + Intronic
1118215886 14:63808222-63808244 AAAGATAAGGAAAAACTGGCTGG - Intergenic
1118294449 14:64556463-64556485 AAAAATAAGTATAAATAGGCTGG + Intronic
1118297655 14:64585217-64585239 CAACAAAAGCAGAAGCAGGCCGG + Intronic
1118717374 14:68569868-68569890 AAAAGTGAGGAGAGGCAGGTGGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1120367761 14:83592148-83592170 AAAAATAAGGCAAAGCAGCCGGG + Intergenic
1120515190 14:85462178-85462200 AAAAAGGAAGAGAGGCAGGCAGG - Intergenic
1120525368 14:85570879-85570901 AAAAATAAGGGGAATTTGGCCGG - Intronic
1120867885 14:89311192-89311214 AAAAATAAGGTGTATCGGGCCGG + Intronic
1121135373 14:91493090-91493112 AAAAATAAGAAAAAGTAGGCTGG + Intronic
1121852549 14:97235671-97235693 AAAGAAAAGGAAAAGCAGGGAGG - Intergenic
1122611812 14:102989574-102989596 AAAAAGAATGAAGAGCAGGCCGG + Intronic
1123801531 15:23826149-23826171 CAAAATATGGAGAGACAGGCAGG - Intergenic
1124266653 15:28241523-28241545 CAAAAGAAGTAAAAGCAGGCCGG + Intronic
1124909751 15:33907461-33907483 AAAAATATGGAACAGAAGGCTGG - Intronic
1124992164 15:34685835-34685857 AATAATATGGAGAAGTAGGATGG + Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125446273 15:39760840-39760862 TAAGATTAGGAGAAGCAGGGGGG + Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1125713134 15:41803428-41803450 AAAAAAAAGGTTAAGCAGGCAGG + Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125845728 15:42851333-42851355 AAAAAGCAGAAGAAGCAGGCAGG + Intronic
1125931920 15:43606303-43606325 AAAAAAAAGTAAAAACAGGCCGG + Intronic
1125945019 15:43705781-43705803 AAAAAAAAGTAAAAACAGGCCGG + Intergenic
1125964334 15:43861193-43861215 AAAAATATGTAGGATCAGGCCGG - Intronic
1126008137 15:44278295-44278317 AAAAATAAGGCTATGGAGGCTGG + Intergenic
1126371004 15:47947070-47947092 AAAAATAAGGAAAAGGAGAAAGG + Intergenic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127285848 15:57533067-57533089 AAGAATACGGAAAAGCAGCCAGG - Intronic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128135623 15:65261178-65261200 AAAAAAACGGAGAATCTGGCAGG + Intronic
1128173597 15:65533754-65533776 AAAAAGAAAGAAAAGCAGCCGGG + Intronic
1128661778 15:69506600-69506622 AAAAAAATAGAGAAGAAGGCTGG - Intergenic
1129106873 15:73315856-73315878 AAAAAGAAGAAGAAGAAGGTGGG + Intergenic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1129661008 15:77552907-77552929 AAAAAAAAAGAGAAGCCAGCAGG + Intergenic
1129821713 15:78606929-78606951 AAACATAAGAACAAGCAGTCTGG + Intronic
1129886278 15:79040055-79040077 AAATATAAGCAAAATCAGGCTGG - Intronic
1129996800 15:80013787-80013809 TAAAAAATGGGGAAGCAGGCTGG - Intergenic
1130561144 15:84960220-84960242 AAAAAAAAAAAAAAGCAGGCAGG - Intergenic
1130620712 15:85459493-85459515 AAAAAAAAGAAAAAGCAGGCTGG - Intronic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132189448 15:99838794-99838816 AACAATATGGAGAACCAGGAGGG - Intergenic
1133084761 16:3353502-3353524 AAAAAAAAGAATAAGTAGGCCGG + Intergenic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133417962 16:5621135-5621157 AAAAATAAAAATTAGCAGGCTGG - Intergenic
1133915595 16:10106742-10106764 AGAAAAAAGGAGAATAAGGCAGG + Intronic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1133983166 16:10648626-10648648 AAAAACCAGGGGATGCAGGCAGG - Intronic
1134006800 16:10823298-10823320 AAAAATAAGGGAACTCAGGCAGG + Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134349735 16:13425513-13425535 ATAAATAAGCAAAAGCAGGGAGG + Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134656666 16:15952731-15952753 AAAAAAAAAAAAAAGCAGGCCGG + Intronic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134873158 16:17670016-17670038 AAAAATAATTAACAGCAGGCCGG - Intergenic
1134880785 16:17743798-17743820 AAGGATGAGGAGAAGCAGACAGG + Intergenic
1134903128 16:17956559-17956581 AAAAAAAATGATAAACAGGCCGG + Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135010622 16:18874567-18874589 AAAAAAAAAAAAAAGCAGGCTGG + Intronic
1135091368 16:19520733-19520755 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135398745 16:22150982-22151004 AGAAATTAGGAGAAGCGGCCGGG + Intronic
1136385587 16:29923876-29923898 AAAAGTAAAGAAAAGAAGGCCGG + Intronic
1136484169 16:30560616-30560638 AAAAAAAAGAAGAAGAGGGCCGG + Intergenic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1137418724 16:48311929-48311951 AAAAAAAAGAAGAAGCTGTCAGG - Intronic
1137541883 16:49368774-49368796 AAAAATAAGGAAAATTAGCCAGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1138052128 16:53790418-53790440 TAAAATCAGGAGAAACAGGGTGG + Intronic
1138148289 16:54631719-54631741 AAAAATATGGTCAAGTAGGCAGG + Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139108916 16:63864641-63864663 ACAAAAAAGGAGATGCAGGCCGG + Intergenic
1139741244 16:69036972-69036994 AAAAAGAAAAAGAAGAAGGCTGG + Intronic
1139834314 16:69825969-69825991 AAATAAAAGTAGAAGCAGCCAGG + Intronic
1140115443 16:72037483-72037505 AAAAATAAAAGGATGCAGGCTGG + Intergenic
1140773151 16:78224297-78224319 ACAAAGAAGGAAAAACAGGCCGG - Intronic
1141190905 16:81823967-81823989 AAAAAGAAGGAAAAGAAGGAAGG - Intronic
1141457916 16:84156494-84156516 CAACAAAAGGAGAAGCAAGCAGG - Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1141873281 16:86804320-86804342 AAAAAGAAGAAGAAGAAGGGAGG + Intergenic
1141911712 16:87064671-87064693 GAAAGTAAGCAGAAGCGGGCTGG - Intergenic
1141941187 16:87277214-87277236 AAAAGAAAGGAGCAGAAGGCCGG + Intronic
1142107230 16:88310787-88310809 AAAAATAAAAAGCAGCAGCCTGG - Intergenic
1142225606 16:88875885-88875907 ACACATATGGAGACGCAGGCCGG + Exonic
1142400826 16:89857864-89857886 AAAAAGAAGAAGAACTAGGCTGG - Intronic
1142431349 16:90029631-90029653 AACAAGAAGGAGCAGCAGGAGGG - Intronic
1142522650 17:515948-515970 AAAAAAAAAAAAAAGCAGGCAGG - Exonic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142898335 17:2996371-2996393 GAAAATAAGAAAATGCAGGCAGG + Intronic
1142899193 17:3001954-3001976 AAAAAAAAGGAGAAGAAGAGTGG - Intronic
1142959856 17:3545687-3545709 AAAAAAAAGAGGGAGCAGGCCGG + Intronic
1143267295 17:5649032-5649054 AAAAATAACTGGAAGCCGGCAGG - Intergenic
1143346343 17:6252187-6252209 AAAAAAAAAAAGAAACAGGCCGG + Intergenic
1143525991 17:7472942-7472964 AAAAAAAAAGAGAAGCAGTTGGG - Intronic
1143606288 17:7988286-7988308 AAACATACAGAGAAGGAGGCCGG - Intergenic
1144007527 17:11114716-11114738 AAAAAAAAGCAGAAGCAAACAGG - Intergenic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144171064 17:12660439-12660461 AAAAATAAGAACAACTAGGCTGG - Intergenic
1144429822 17:15181072-15181094 AAGAATAAGGACACACAGGCCGG - Intergenic
1144540087 17:16132913-16132935 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1144594561 17:16557609-16557631 AAAATTAAGTACAAGCAGGAAGG + Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145892508 17:28427033-28427055 AAAAAAAACAAGAAGAAGGCTGG + Intergenic
1146303574 17:31711174-31711196 AAAAAAGAGGAAAAGCTGGCTGG + Intergenic
1146332696 17:31941211-31941233 AAAAATAAGGAGGCTGAGGCAGG - Intronic
1146698089 17:34927098-34927120 AAAAAGAAGAAGAAGAAGTCTGG + Intergenic
1147191506 17:38740596-38740618 AAAAATACGGAAAATCAGCCAGG + Intronic
1147298021 17:39500334-39500356 AAAAAAAAGAAGAAAAAGGCTGG + Intronic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1147801154 17:43089329-43089351 AAAAATTAGGAGAAAGAGCCTGG + Intronic
1147857003 17:43488617-43488639 AAAAAAAAGAAGAACTAGGCAGG + Intronic
1148014262 17:44509993-44510015 AAAAAAAAAGAGAAGAAGGGAGG + Intergenic
1148211688 17:45812713-45812735 AGAAATAGAGAGAGGCAGGCGGG - Intronic
1148329885 17:46807505-46807527 AAAAAGAAACAGAAGCAGACTGG + Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148610069 17:48959148-48959170 AAAAATAAGTAAAATGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148706402 17:49637345-49637367 AAAAAAAAGGAGAACCAGCTTGG - Intronic
1149395696 17:56240209-56240231 AAAAACAAGGATAAGCATACAGG - Intronic
1149479128 17:56987452-56987474 AAAAAAAGGGAGAGGCAGGAAGG - Intronic
1149509371 17:57226125-57226147 AAAAAAAAAGAAAAGAAGGCTGG - Intergenic
1149623750 17:58065073-58065095 CAAAATAAGGAGAGGCCTGCTGG - Intergenic
1149837362 17:59925124-59925146 AAAAATAAGAAAAATCAGCCGGG - Intronic
1149893110 17:60407799-60407821 AAAAAAAAGCAGAAACAGGCCGG + Intronic
1150504652 17:65685957-65685979 AAAAATAATTAGAATTAGGCTGG - Intronic
1150647836 17:66990974-66990996 TAAAATAAGGAGACTTAGGCCGG - Intronic
1150666767 17:67147467-67147489 AAAAATAAGAATAAAAAGGCAGG - Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150766937 17:68009890-68009912 AAAAAAAAGAAGAAGAAGGTGGG - Intergenic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1151226801 17:72654087-72654109 GAAAATAAGGAAAAGCAAGATGG - Intronic
1151606202 17:75137943-75137965 AAAAAAAAGGAAAACTAGGCCGG - Intronic
1152159162 17:78656611-78656633 AAAAAAAAATAGAAGCAGGAGGG + Intergenic
1152513392 17:80805429-80805451 TAAAATAAGGGGAAGCAGGACGG - Intronic
1152765027 17:82131963-82131985 AAAAATAAGGCCAGGCATGCTGG + Intronic
1153069831 18:1092393-1092415 GGAAATAAGGAAAAGCAAGCTGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153460580 18:5328397-5328419 AAAAAGAAGAAGAAGAAGGAAGG + Intergenic
1153679497 18:7486733-7486755 AAAAATTAAGAGGAGCAGGGAGG - Intergenic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1153890426 18:9509296-9509318 AAAAATATTGAGAGGAAGGCTGG + Intronic
1153939995 18:9969191-9969213 GAAGATGAGGAGAAGCAGGCGGG - Intergenic
1154114347 18:11598057-11598079 TAAAAAAAGGAGAATCAAGCAGG + Intergenic
1154271677 18:12925787-12925809 AAAAAAAAGTAGAGACAGGCTGG + Intronic
1155050526 18:22143456-22143478 AAAAATAAAACCAAGCAGGCTGG - Intergenic
1155057578 18:22198365-22198387 AACAAGAAGCATAAGCAGGCTGG - Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155221922 18:23693054-23693076 AAAAATATGGAGAGGCATGGTGG + Intronic
1155233675 18:23798079-23798101 AAAAAGGAGGAGACGAAGGCAGG - Intronic
1155620178 18:27769136-27769158 AAAAAATAGAAGAGGCAGGCAGG + Intergenic
1155791717 18:29979953-29979975 AGAAATAAGGAGAACCATGAGGG - Intergenic
1156694824 18:39753684-39753706 AAAAAAAAAAAGAAGCAGTCTGG - Intergenic
1156761854 18:40601467-40601489 AAAAAGAAAGAAAGGCAGGCAGG - Intergenic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1156950472 18:42890578-42890600 AGAGAGAAGGAGAAGCAGGGAGG + Intronic
1157032733 18:43932433-43932455 AAAAGTAAATAGTAGCAGGCAGG + Intergenic
1157403692 18:47406352-47406374 AAAAATATTGAGCAGCCGGCAGG - Intergenic
1157434500 18:47657003-47657025 GAAAATACAGAGAAGCATGCAGG + Intergenic
1157469486 18:47977902-47977924 TAAAATATGGAAAAGCAGGCCGG - Intergenic
1157495117 18:48151528-48151550 AAAGATAAGGAAACGGAGGCTGG + Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1158777207 18:60597729-60597751 AAAAATAAGGAAAATCCAGCTGG + Intergenic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159219349 18:65439625-65439647 GGAAATAAGGAGAAACAGACTGG - Intergenic
1159770908 18:72544161-72544183 AAAAAAAAGAAGAAGAAGACTGG + Exonic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1160110795 18:76028064-76028086 AAAAACAAAGAGGAGCAGGAGGG + Intergenic
1160146127 18:76366496-76366518 CAAAACAAAGAGAAGCACGCTGG + Intronic
1160664521 19:318758-318780 AAAAATCAGTAAAAGGAGGCTGG + Intronic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162035967 19:7939617-7939639 AAAAAAAAAAAAAAGCAGGCTGG + Intronic
1162251158 19:9444693-9444715 AAAAAGAAAGAGAAGAAGGAAGG + Intergenic
1162414980 19:10530421-10530443 AAAAAAAAATAGAAACAGGCTGG + Intergenic
1162415030 19:10530728-10530750 AAAAAAAATTAGAAACAGGCCGG + Intergenic
1162458429 19:10799828-10799850 TAAAAAAAGAAAAAGCAGGCTGG - Intronic
1162484334 19:10949758-10949780 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162485191 19:10956025-10956047 AAAAAAAAAAAGAAGAAGGCCGG + Intergenic
1162593888 19:11612414-11612436 AAAAAAAAAAAAAAGCAGGCCGG - Intronic
1162949984 19:14065520-14065542 AAAAATAATAAAAAGAAGGCTGG + Intergenic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163457478 19:17416404-17416426 AAAAAAAAAAAAAAGCAGGCTGG - Intronic
1163624440 19:18380911-18380933 AAAAAAAAGGACTACCAGGCTGG - Intronic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1163995217 19:21039234-21039256 AAAAATAAGGCCAAGCATGGTGG - Intronic
1163996146 19:21048906-21048928 AAAAATAAGGCCAAGCATGGTGG + Intronic
1164094570 19:21995246-21995268 AAAAAATAGAAGAAACAGGCTGG - Intronic
1164114151 19:22200843-22200865 AAAAAATAGAAGAAGCAGGCTGG - Intergenic
1164245372 19:23423548-23423570 AAAAAAAAAAAGAACCAGGCAGG - Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164931190 19:32177546-32177568 AAAAAGAAGGAAAGGAAGGCAGG + Intergenic
1164987374 19:32658364-32658386 AACAGGAATGAGAAGCAGGCAGG - Intronic
1165243919 19:34487094-34487116 AAAAAAAAAAAAAAGCAGGCAGG - Intronic
1165580838 19:36862155-36862177 AAAGATAAAGAGAAGTTGGCCGG - Intronic
1165836866 19:38763136-38763158 AAAAAGAAGAAGAAGAAGCCAGG + Intronic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1166229732 19:41419428-41419450 AAAAATAAGAAGAAGAAGTCTGG - Intronic
1166600228 19:44087578-44087600 AAAAAAAAGCAGAAGCAGCATGG - Exonic
1166666784 19:44684900-44684922 AAAAAAAAGGAGCAGCAAGGAGG + Intergenic
1166797013 19:45432700-45432722 AAAAATAAATAAAAGCAGCCAGG - Intronic
1167084918 19:47302831-47302853 GAAAAGAAGAAGAAGAAGGCCGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167119702 19:47509426-47509448 ACACATAAGGAAACGCAGGCTGG - Intronic
1167164350 19:47788298-47788320 TAAAAAAAAGAAAAGCAGGCCGG - Intergenic
1167370910 19:49081315-49081337 ATAAATAAAGAGAGGCAGCCAGG + Intergenic
1167641422 19:50684520-50684542 AAAAATCAAGAGTAGGAGGCTGG - Intronic
1167887381 19:52513014-52513036 AAAAATAATAATAAACAGGCTGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168641916 19:58036408-58036430 AAAAATAAAAATAAGCAGGGAGG - Intronic
1168673669 19:58260580-58260602 AAGAATAAGAATAAGCAGGGAGG - Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925809058 2:7680460-7680482 TCAGATAATGAGAAGCAGGCCGG - Intergenic
926082011 2:9994936-9994958 AAAAACCAGGGGAAGGAGGCTGG - Intronic
926346545 2:11951943-11951965 AAAAATATGAAAATGCAGGCCGG - Intergenic
926502635 2:13674779-13674801 AAAAATAATAAGAAAAAGGCAGG + Intergenic
926562571 2:14434233-14434255 AAAAATACTGAGAAGAAGGAAGG + Intergenic
926564673 2:14456193-14456215 AAAAAAAAGGAAAATCAGGAAGG + Intergenic
926677675 2:15639850-15639872 AAAAATTAAGAGCTGCAGGCTGG - Intergenic
926899886 2:17739342-17739364 AAAAATAAAATTAAGCAGGCTGG + Intronic
926905669 2:17802789-17802811 AAAAAAAAAAAAAAGCAGGCAGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
927578641 2:24221949-24221971 AAAAAAAAGCAAAAGCAGCCGGG + Intronic
927598042 2:24414741-24414763 AAAGATAAGGAGAGGATGGCTGG - Intergenic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927775228 2:25897587-25897609 AAAAATATCCAGAAGCAGGCAGG - Intergenic
927977624 2:27351113-27351135 AAAAATAAAAAATAGCAGGCCGG + Intronic
928450079 2:31370843-31370865 ATAAATAAAGTGAAGAAGGCAGG + Intronic
928469940 2:31564463-31564485 AAAAGAAAGGAGAAGTAGGGAGG + Intronic
928620203 2:33081275-33081297 AAAAAACAGCAGAAGCAGGAAGG - Intronic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929050858 2:37835444-37835466 AAAAATGAAGAGAAGCGGCCGGG - Intergenic
929154970 2:38780966-38780988 AAAAAAAAAAAGAAGAAGGCAGG - Intronic
929377331 2:41303989-41304011 TAAAATAAGGGGAAGCTGGGTGG + Intergenic
929487144 2:42364931-42364953 GCACATAAGGAAAAGCAGGCAGG - Intronic
929489208 2:42381558-42381580 AAAGATCATGACAAGCAGGCAGG - Intronic
929555676 2:42924340-42924362 AAAAAAAAGGTAAAGCAGCCTGG + Intergenic
929739383 2:44587634-44587656 AAAAAAAAGGAAAACCAGTCAGG - Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929855558 2:45635928-45635950 AAAAAGAAGAAGAAGAAGGGTGG + Intergenic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930203343 2:48565031-48565053 AAAAAAAAGAAGAAGCCGGAGGG - Intronic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930671692 2:54158336-54158358 AAAAAATAAGAAAAGCAGGCCGG - Intronic
931223703 2:60310989-60311011 AAAAAGAAGAAGAAGAAGCCTGG + Intergenic
931371269 2:61665350-61665372 AAAAATTAATAGAAGCAGGACGG + Intergenic
931607303 2:64065320-64065342 AAAAAAAAAAAGCAGCAGGCAGG + Intergenic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
932323459 2:70838602-70838624 GAAAAGACAGAGAAGCAGGCAGG + Intergenic
932379601 2:71270043-71270065 AAAAAAAAAAAGAAGCAGTCTGG - Intergenic
932913805 2:75833691-75833713 AAAAATAAGTAGCTACAGGCAGG - Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933260030 2:80122197-80122219 AGAAATAGGGAGAAACAGGACGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934183596 2:89650602-89650624 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934293879 2:91724774-91724796 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
934526480 2:95055273-95055295 AAAAAGAAGAAGAAGAAGGAGGG + Intergenic
934554373 2:95279588-95279610 AAAAATATGCAGAAGCGGCCGGG - Intronic
935241870 2:101185911-101185933 AAATATGAGGACAAGGAGGCTGG - Intronic
935612819 2:105043579-105043601 AAAAAGAAAGGAAAGCAGGCAGG - Intronic
935647783 2:105355196-105355218 AAAAAGAAGGAAAAGAAGGAAGG + Intergenic
935942252 2:108252851-108252873 AAAAAGGAGGAGAAGTAGGGGGG + Intronic
936417971 2:112336866-112336888 AAAAATAAGGAGATACATGTGGG - Exonic
936574018 2:113638569-113638591 TAAAATAGGTAGAAACAGGCTGG + Intronic
937657444 2:124392703-124392725 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937829610 2:126405081-126405103 AAAAAAAAGGTGAAGCAGATTGG + Intergenic
938027637 2:127964195-127964217 AAAAATAAGGAAATTTAGGCTGG + Intronic
938143974 2:128819120-128819142 GAAAATAAGGGTAAGAAGGCTGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938367063 2:130743220-130743242 TAAAAAAAGCAGAACCAGGCTGG - Intergenic
938457208 2:131474391-131474413 AAAAAAAAGAAGAAGAAGACTGG - Intronic
939680878 2:145130321-145130343 AAAAAAAAGAAGAAGCATGTTGG - Intergenic
939786828 2:146524903-146524925 ACAAATAAATAGAAGTAGGCGGG - Intergenic
939898130 2:147817522-147817544 AAAAATAAACATAAGCAGGCTGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940235513 2:151507375-151507397 AAAAAACAGCAGAAGCAGGAGGG + Intronic
941069721 2:160942452-160942474 AAAAATCAGGGAAAGCAGGGAGG + Intergenic
941446228 2:165603189-165603211 AAACATCAGGAGATTCAGGCCGG - Intronic
941834846 2:170004925-170004947 AAAAAGAAAGAGAACAAGGCTGG + Intronic
942049172 2:172122762-172122784 AAAAATAGAAAAAAGCAGGCCGG + Intergenic
942207114 2:173630146-173630168 AAAAATAAGGAAAATATGGCTGG + Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943636728 2:190315245-190315267 AGAAATTAGAAGTAGCAGGCCGG - Intronic
943687272 2:190831673-190831695 AAAAAGAAGAAGAAGAAAGCCGG + Intergenic
943746727 2:191469793-191469815 AAAAAAAAGAAGCAGCAGGCCGG - Intergenic
944071471 2:195674571-195674593 GTAAATAAAGAAAAGCAGGCCGG - Intronic
944380268 2:199101009-199101031 TAACATAACCAGAAGCAGGCAGG + Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
945950177 2:216031910-216031932 AAAAATACGGAGAAGTAGAGAGG - Intronic
946060140 2:216934436-216934458 AGAAAGAAAGGGAAGCAGGCTGG - Intergenic
946249647 2:218404676-218404698 AGAAAAAGGGAGCAGCAGGCAGG - Exonic
946314536 2:218901592-218901614 AAAAAGAAAGACCAGCAGGCAGG + Intergenic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946442902 2:219711969-219711991 AAAAATGAGGAAATCCAGGCTGG + Intergenic
946687975 2:222290932-222290954 AAAAAAGAGGAGAAGAAGGGGGG + Intronic
946705581 2:222455475-222455497 ATAAAAAAGGAGAGGCAGGGAGG + Intronic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947369285 2:229428104-229428126 AAAAGAAAAGAGAAACAGGCAGG + Intronic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947903405 2:233741792-233741814 AAAAATTAAGAGCAGCATGCTGG - Intronic
947904835 2:233753473-233753495 AAAAATTAAGAGCAGCATGCTGG - Intronic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948905023 2:240975711-240975733 AAAAAAAAAAAAAAGCAGGCTGG - Intronic
948998929 2:241600980-241601002 AAAAAAAAGGACAATCTGGCCGG + Intronic
949011517 2:241682049-241682071 AAAAATAAGGCCAGGCAGGGTGG + Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1168911208 20:1448594-1448616 AAAAATTAGGTGAGGCAGGGTGG + Intronic
1169148453 20:3270128-3270150 AAAAAAAAAAAAAAGCAGGCTGG - Intronic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169448456 20:5691480-5691502 AAAAAAAAAGTGAATCAGGCTGG + Intergenic
1169559912 20:6788355-6788377 AAGAATAAGAAGAAACAGACTGG - Intergenic
1169572219 20:6918614-6918636 AAAAAAAAGGAAAAGCAGCTTGG - Intergenic
1169831011 20:9824807-9824829 AAAAAGAAGGAGAGACAGACAGG - Intronic
1170063845 20:12289158-12289180 TAAATTATTGAGAAGCAGGCTGG - Intergenic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1171390980 20:24801659-24801681 AGTAATAAGGAGAGCCAGGCTGG - Intergenic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172378236 20:34464282-34464304 AAAAAAAAGAAAAAACAGGCCGG - Intronic
1172497337 20:35397217-35397239 AAAAAAAAGAAAAATCAGGCCGG + Intronic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172598339 20:36166058-36166080 AATCATCAGGAGAGGCAGGCTGG + Intronic
1172686782 20:36761707-36761729 AAAAATAAGAACAGGCAGGATGG + Intronic
1172769481 20:37371288-37371310 AAAAATAAGAAGAAATAGGCTGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1172972700 20:38885055-38885077 AAAAAGAAGAAGAAGAAGACTGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173835639 20:46123498-46123520 AAAACTGAGGAGAAGCAGGAGGG - Intronic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1174415827 20:50366251-50366273 AAAAATAAGGAAAATTAGACAGG - Intergenic
1174417374 20:50376545-50376567 CAAAATAAGGCGAAGCAGCTGGG + Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174769044 20:53281252-53281274 CTAAATAATGAGAAGCAGCCAGG + Intronic
1175363816 20:58436620-58436642 AAAATAAAGAAAAAGCAGGCTGG - Intronic
1175755632 20:61528077-61528099 AAAAAGAAGAAAAAACAGGCTGG + Intronic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176415771 21:6473961-6473983 AAAAATAAGTTGAATCAGCCGGG - Intergenic
1176415821 21:6474266-6474288 AAAAATAAGTTGAATCAGCCAGG - Intergenic
1176715510 21:10346268-10346290 AAAGATAGAGAGAAGTAGGCAGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177182148 21:17756007-17756029 AAAAATAAAAATAAGCAGCCTGG - Intergenic
1177691542 21:24516383-24516405 AACACTAAGGAAAAGCAAGCTGG - Intergenic
1177943471 21:27439838-27439860 AAAATTAAGGAGCAGAAAGCTGG - Intergenic
1178122323 21:29481767-29481789 AAATAAAAGGGGAAGCAGGCTGG - Intronic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1178302264 21:31463043-31463065 AGACATAAGAAGAGGCAGGCTGG - Intronic
1178414686 21:32393946-32393968 AAAAATAAGTAAAAACAGGCTGG + Exonic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1179149315 21:38796460-38796482 AAAAATGAGAAGAAGCCAGCAGG - Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179622993 21:42631168-42631190 ATCAATAAGGAAAACCAGGCCGG - Intergenic
1179691271 21:43082295-43082317 AAAAATAAGTTGAATCAGCCGGG - Intergenic
1179691321 21:43082600-43082622 AAAAATAAGTTGAATCAGCCAGG - Intergenic
1180018758 21:45105396-45105418 TAAAATACAAAGAAGCAGGCCGG - Intronic
1180025324 21:45157888-45157910 AAGAATACAGAGAAGCACGCAGG + Intronic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180602838 22:17033685-17033707 AAAGATAGAGAGAAGTAGGCAGG - Intergenic
1180620011 22:17154919-17154941 AAAAATAAGGACATTCTGGCTGG - Intronic
1181225900 22:21390592-21390614 AAAAAAACGGAAAAGAAGGCCGG - Intergenic
1181252733 22:21544221-21544243 AAAAAAACGGAAAAGAAGGCCGG + Intergenic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182202282 22:28585983-28586005 AAAAAAAAGAAGAAGAAGCCGGG + Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182768674 22:32777372-32777394 AAAAAAAAGAAGGAGCAGGCTGG - Intronic
1182834485 22:33330833-33330855 AAAAATAAGGACATCCAGTCAGG - Intronic
1182912504 22:33996860-33996882 AACAAAAATAAGAAGCAGGCTGG - Intergenic
1182984269 22:34701709-34701731 ATAAATAAAAAGATGCAGGCCGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183384148 22:37505377-37505399 CAAAATAAGAAAACGCAGGCTGG + Intronic
1183412624 22:37664225-37664247 AAAAAAAAAGAAAAGCTGGCTGG - Intronic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
1184234679 22:43176746-43176768 AAAAAAAAGGAAAAGAAGGAGGG + Intronic
1184313972 22:43667959-43667981 AAAAATCAGGAGACGCAGCGGGG - Intronic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184794679 22:46725025-46725047 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
1185298925 22:50069021-50069043 AAAAAGAAAGAAAGGCAGGCCGG - Intronic
1185328822 22:50242002-50242024 AAAAAAAAGAACAATCAGGCCGG + Intronic
1185426155 22:50772323-50772345 TAAAATAGGTAGAAACAGGCTGG - Intronic
1203290062 22_KI270735v1_random:28033-28055 AAAAATAAGGAAAGGAAGGGAGG - Intergenic
949177152 3:1078464-1078486 CAAAATATTGAGAATCAGGCTGG + Intergenic
949543678 3:5054108-5054130 AGAATTAAAGAGAAGCAGGATGG - Intergenic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
949732229 3:7126731-7126753 AAAAGGAAGGAGAAGCAGAGAGG - Intronic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
949809624 3:7992194-7992216 ATAAGCAGGGAGAAGCAGGCAGG + Intergenic
949932958 3:9093889-9093911 AAAAATAAGGAAAGTCAGGTTGG - Intronic
950035626 3:9883157-9883179 AAAAAAAAAAAGAAGAAGGCCGG - Intergenic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950072206 3:10161705-10161727 GAAGAGAAGGAGAAGCAGGTAGG + Intergenic
950209375 3:11109369-11109391 AAAAATAAGCAGAAACAAGTAGG - Intergenic
950255690 3:11503460-11503482 AAAAAAAAGGATATTCAGGCCGG + Intronic
950506116 3:13395612-13395634 AAAAAGAAGGAAATACAGGCTGG - Intronic
950931178 3:16790473-16790495 AAGAATTTGGGGAAGCAGGCTGG - Intergenic
951060654 3:18202915-18202937 AAAAAGAAGAAGAATCAGACTGG - Intronic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
951836263 3:26986693-26986715 AGATAATAGGAGAAGCAGGCTGG - Intergenic
952242679 3:31549305-31549327 ACAAATCAGGAGAATCAGGGGGG - Intronic
952347833 3:32504720-32504742 AAAAAAAAAAAAAAGCAGGCCGG + Intergenic
952959056 3:38578406-38578428 CTATATAAGGAGAAACAGGCTGG - Intronic
953175497 3:40547982-40548004 AAAGATACTGAGAAACAGGCTGG + Intronic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953966326 3:47309838-47309860 AAAAATAACGAAAACCAGTCAGG + Intronic
954068579 3:48126401-48126423 AAAAAAAAGAAGAAGCAGAGAGG - Intergenic
954241316 3:49296033-49296055 AAAAAGTAGCAGATGCAGGCCGG + Intronic
954241762 3:49299382-49299404 AAAAAAAAGTTGAGGCAGGCTGG - Intronic
954514813 3:51164324-51164346 CAAAATAAAGAGATTCAGGCCGG + Intronic
954521062 3:51227012-51227034 AAAAACAGAGAGAAGCAGGGTGG - Intronic
954736228 3:52709024-52709046 AAAAATAACGAAAATCAGCCAGG + Exonic
955289071 3:57674084-57674106 AAAAATACTGGGAAGCCGGCCGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955413771 3:58673359-58673381 AAAAATAAGGTGAAAGAGGGAGG - Intergenic
955620126 3:60854542-60854564 AAAAAAAAATAGAAGTAGGCTGG - Intronic
955786947 3:62550931-62550953 AAGACTAAGGAGCAGCAGCCAGG - Intronic
955997909 3:64696579-64696601 AAAAAAAAAAAGAAGCAGCCAGG + Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956635642 3:71361904-71361926 AAAAATAAGGAACAGCTGACTGG + Intronic
956893796 3:73639262-73639284 AAAATGAGGGAGAAGCAGCCAGG + Intergenic
956960387 3:74392399-74392421 AAGAAAAAGAAGAAGCAGGGTGG - Intronic
957047336 3:75386185-75386207 AGAAAGAAGGAGAAGAAGGAAGG + Intergenic
957523832 3:81354996-81355018 AAATATAAGGACAAGCAAGATGG + Intergenic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957544126 3:81614567-81614589 AAAAATAAGGAAAATCAGCACGG + Intronic
957696909 3:83650444-83650466 AAAAACAAGAAAAAGCAGGGTGG - Intergenic
959191340 3:103115180-103115202 AAAAACAAGGAGAAGAATTCAGG + Intergenic
959447664 3:106459959-106459981 AAATAAAAAGAGAAACAGGCCGG - Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959538045 3:107509398-107509420 AAAAATAAGAAGAATAGGGCTGG - Intergenic
959566073 3:107834487-107834509 AAGACTAAGAAGAAGCAGGGGGG + Intergenic
960125184 3:113990803-113990825 AAAAAAAAGGAAATGCAGGCTGG + Intronic
960275844 3:115728315-115728337 TAAATCAAGGAGAAGAAGGCAGG - Intergenic
960313664 3:116149254-116149276 AACAATATGGGGAAGAAGGCTGG + Intronic
961031104 3:123604658-123604680 AAAAACAAGGTGATTCAGGCTGG - Intergenic
961056768 3:123795550-123795572 AAAAATCTGAAGAACCAGGCTGG + Intronic
961241119 3:125412502-125412524 AAAAAGAAGAAGAAGAAGCCAGG + Intergenic
961299063 3:125910333-125910355 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
961529333 3:127530742-127530764 AAAAAAAAACAGAAACAGGCTGG + Intergenic
961602856 3:128074545-128074567 AAAAATAACCATAAGCAGCCGGG + Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961783110 3:129333092-129333114 AAAAAAAAAAAAAAGCAGGCCGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961984036 3:131113614-131113636 GAAAAAAAGAAAAAGCAGGCCGG + Intronic
962042249 3:131719548-131719570 AAAAAGAAGGACAGGCTGGCTGG - Intronic
962048356 3:131785390-131785412 AAAAATAAGCAGAAACATGAAGG - Intronic
962319335 3:134377658-134377680 AAAAAAATGAAGAAGCAGCCAGG + Intergenic
962336587 3:134537286-134537308 TAAAATAATGAGAAGCAGATAGG + Intronic
962724548 3:138210450-138210472 AAAAATTAAGAGAAGCAAGTAGG + Intronic
962769688 3:138600898-138600920 AAAAAGAAGGAGGAGAAGGAGGG + Intergenic
962798087 3:138866133-138866155 AAAAATAAGATAAAGCGGGCTGG + Intergenic
963045919 3:141102653-141102675 AAAAAGCTGGAGAGGCAGGCAGG + Intronic
963056997 3:141194022-141194044 AAAAAGAAAAAGAAGCAGTCTGG - Intergenic
963201479 3:142590781-142590803 AAAAATAAGTAAAAGAAGGCTGG - Intergenic
963339361 3:144015955-144015977 ACAAAAAAGGAGAAGCAGTGGGG - Intronic
963356238 3:144211914-144211936 AAATATAAGGTGAAGCAGACAGG - Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
964272859 3:154977416-154977438 AAAAAAAAAAAGAATCAGGCCGG + Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964537343 3:157738395-157738417 AAAAGAAAGAAGAACCAGGCTGG + Intergenic
964823657 3:160801901-160801923 AAAAGTAAGAAGAAACAGGAAGG - Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965107518 3:164376473-164376495 AAAAATAAGTGGAACTAGGCCGG + Intergenic
965531086 3:169770021-169770043 TAAAATAAGGAGAAAAATGCTGG + Intergenic
965611540 3:170549203-170549225 AAAAAAAAAAAGAAGAAGGCCGG - Intronic
965617141 3:170606102-170606124 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
965751859 3:171983644-171983666 AAAAATTAGCAGGAACAGGCTGG + Intergenic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966958586 3:184910257-184910279 AAAAATTAGGAGAATCTTGCCGG - Intronic
967076506 3:186007933-186007955 AAAAATAATCACAATCAGGCCGG - Intergenic
967144878 3:186598134-186598156 AAAAAAAAAGAAAACCAGGCTGG - Intergenic
967216177 3:187212484-187212506 AAAAATAAGGAGAAACTAACAGG + Intergenic
967310945 3:188105543-188105565 GTAAAAAAGTAGAAGCAGGCTGG - Intergenic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967579299 3:191133599-191133621 AAAAATAAGAAGAATCAGCTTGG - Intergenic
967634659 3:191787440-191787462 AAAAATAATGATGAACAGGCCGG + Intergenic
967778008 3:193404651-193404673 AAAGCAAAGGGGAAGCAGGCAGG - Intronic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968347848 3:198026113-198026135 AAAAATAAGAAAAATCAGCCAGG - Intronic
968692096 4:1996951-1996973 AAAAAAAAAGAAAAGTAGGCAGG + Intronic
968698577 4:2044171-2044193 CAAAACAAGGGGAGGCAGGCAGG - Intergenic
968866301 4:3214176-3214198 AAAAACATGGTGAAGCAGACAGG - Intronic
968897023 4:3410356-3410378 AAAAATAAGATCATGCAGGCTGG - Intronic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969838398 4:9862076-9862098 AAAAAGAAGTAGATGCAGGAAGG + Intronic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970130210 4:12861135-12861157 AAAAATAACTAGTAGCAGGAGGG - Intergenic
970310368 4:14776606-14776628 AGCAATAGGGAAAAGCAGGCAGG + Intergenic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971016809 4:22497412-22497434 AGAAATTCAGAGAAGCAGGCTGG + Intronic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971477299 4:27084380-27084402 AAAATTAAGGAGTTGAAGGCTGG - Intergenic
972362228 4:38337756-38337778 AAAAAACATGAGAAACAGGCTGG + Intergenic
972422591 4:38903458-38903480 AAAAATGAGGTCAAGGAGGCTGG - Intronic
972490711 4:39584497-39584519 AAAAAAAAAGACAAACAGGCTGG + Intronic
973337439 4:48970939-48970961 AAAATAAAGGAAAAGCAGGGAGG - Intergenic
974938892 4:68440111-68440133 TACAATAAAGAAAAGCAGGCTGG - Intergenic
975228470 4:71902948-71902970 AAAAAGAAGGAAATGAAGGCAGG - Intergenic
975990576 4:80256086-80256108 GAAAAAAAGGAGAAGCAGTAGGG - Intergenic
976851901 4:89557335-89557357 AAAGATAAGGAGGAGCAGGCAGG + Intergenic
976943764 4:90739129-90739151 AATAATGAGCAGTAGCAGGCAGG - Intronic
977539292 4:98297005-98297027 AAAAAAAAAGAGAACGAGGCAGG - Intronic
978458996 4:108929543-108929565 AAATATAAAAAGATGCAGGCTGG + Intronic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
979155300 4:117379834-117379856 AAAAATGAGGAGAAGCTGATAGG + Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
979996919 4:127442427-127442449 AAGAATAGGGAGAACCGGGCAGG + Intergenic
980554807 4:134389298-134389320 AACACAAAGGAGAAGCAGACTGG + Intergenic
980907836 4:138965771-138965793 AAAAATAAAAAAAAACAGGCCGG + Intergenic
981123334 4:141077681-141077703 AAACATAAGGAAAAGAAGGCTGG - Intronic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
981363903 4:143879005-143879027 AAAAATAATGAGAAGAAAGGAGG + Intronic
981374631 4:143999780-143999802 AAAAATAATGAGAAGAAAGGAGG + Intronic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
982869046 4:160552853-160552875 AAAAATATACAGAAGTAGGCAGG + Intergenic
983347485 4:166545706-166545728 AAAAATAAGGAGACCCTGGGAGG - Intergenic
983504499 4:168538163-168538185 AAAAATAAGTAGAAGCAAAACGG + Intronic
983555308 4:169054269-169054291 AAAAATATGGAGATGTAGCCGGG - Intergenic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
984090101 4:175362739-175362761 AAAAATGAAGAGAAGCTGGGAGG + Intergenic
984118616 4:175713485-175713507 AAAAATAGGGACTATCAGGCAGG - Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984886609 4:184455287-184455309 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
985117757 4:186607830-186607852 ACAAATAAGGAGAGGCAGCAAGG - Intronic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985198774 4:187462313-187462335 TAAAATTTGGAGAAGCAGCCAGG + Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985279564 4:188271794-188271816 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
985317431 4:188672904-188672926 AGAAATCTGGAGAAGCAGTCTGG - Intergenic
985481825 5:117002-117024 AGAAAGAAGGTGAAACAGGCAGG - Intergenic
985504422 5:271006-271028 AAAAGAAAGCAAAAGCAGGCCGG - Intergenic
985707850 5:1411650-1411672 AGAAACAAGGAGGAGCAGGAGGG + Intronic
985743678 5:1634529-1634551 AAAAAAAAAAAAAAGCAGGCCGG + Intergenic
986001168 5:3631885-3631907 AGAAAGAAAGAGAGGCAGGCAGG - Intergenic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
986070733 5:4279973-4279995 AAAAATCAGGAGATCCATGCAGG - Intergenic
986074719 5:4324507-4324529 GGAAATAAGGAAAAGCAGGATGG + Intergenic
986606390 5:9527367-9527389 AAAAAGAAAGAGAAGTATGCTGG - Intronic
986833941 5:11613263-11613285 AAAATTATGGAGAAGAAGCCAGG - Intronic
986989111 5:13531207-13531229 AAAAAAAAGAAGAAGTAGGAAGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987447264 5:18035106-18035128 AAAATGAAGGGGAAGCCGGCAGG - Intergenic
987570268 5:19648116-19648138 AGTTATAAAGAGAAGCAGGCTGG + Intronic
987889761 5:23862317-23862339 ACAAGGAAGGAGAAGCAAGCAGG + Intergenic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988496082 5:31747462-31747484 AAAAAACAGCAGAAGCAGGGAGG - Intronic
988857499 5:35243197-35243219 AAAAAGAAGGCAAAGTAGGCTGG + Intergenic
988869457 5:35372916-35372938 AAAAAGAAAGAGAAGCAAGCAGG - Intergenic
988872587 5:35407095-35407117 AACAAATAGTAGAAGCAGGCAGG + Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990037433 5:51338663-51338685 AAAAATAAGGAAAATTAGCCAGG - Intergenic
990217965 5:53555009-53555031 AAAAAAAATGAGAAACAGACAGG + Intergenic
990220852 5:53586817-53586839 AAAAAAAGGAAGAAACAGGCTGG - Intronic
990906075 5:60804731-60804753 AAAAATAAGGGAAAGCAAGAGGG + Intronic
991079145 5:62576628-62576650 AAAAATAAGAAAAAGCATGGTGG + Intronic
991901551 5:71465557-71465579 TAAAATAAAGAGAAACAGACAGG - Intronic
992021030 5:72624350-72624372 AAAAACAAAGAGAAACAGACTGG - Intergenic
992247430 5:74840530-74840552 AAAAAAAAAAAAAAGCAGGCCGG + Intronic
992446323 5:76837498-76837520 AAAAATAATGAGAAACAGGCAGG - Intergenic
992719255 5:79543667-79543689 ATAAAGAATGAGAAACAGGCTGG - Intergenic
992948707 5:81835094-81835116 AAAAATAAAGAGATGAAGGAAGG + Intergenic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
993392578 5:87338666-87338688 AAAAATAAGCACAAATAGGCCGG - Intronic
994409906 5:99393998-99394020 AGAAATAACTAGAATCAGGCTGG + Intergenic
994483917 5:100371277-100371299 AGAAATAACTAGAATCAGGCTGG - Intergenic
995074105 5:107961046-107961068 AGTGATACGGAGAAGCAGGCTGG + Intronic
995156532 5:108920891-108920913 AATAATGAGGGGAAGTAGGCAGG - Intronic
995341219 5:111062848-111062870 AAAAAAAATGTGAAGCAGCCTGG + Intergenic
995865938 5:116690731-116690753 AAAAACAAGTTGAAGCAGGTAGG + Intergenic
995871106 5:116744185-116744207 AAAAATACAGAGAAGTAGACAGG + Intergenic
995918751 5:117284469-117284491 GAAGAACAGGAGAAGCAGGCCGG - Intergenic
996517718 5:124391763-124391785 AAAAAGAAGGAAAATCAGGCCGG + Intergenic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
996601589 5:125270499-125270521 AAAATTAAAGAGAAACAGGCTGG + Intergenic
996614650 5:125426364-125426386 AAAAATATGAAGAAGCTGGGAGG + Intergenic
997211339 5:132078795-132078817 GGACATAAGGACAAGCAGGCTGG - Intergenic
997230162 5:132236576-132236598 AAAAATAGAGAGAGGCAGCCTGG - Intronic
997317102 5:132945762-132945784 AAAAATAAAAATAAACAGGCCGG + Intronic
997421674 5:133773670-133773692 AAAAAGAAGATGAAGCACGCAGG - Intergenic
997533805 5:134600027-134600049 AAAAAAAAGAAAAAGAAGGCTGG + Intergenic
997547265 5:134719393-134719415 AAAAAAAAGAAGAAGTTGGCTGG + Intronic
997567132 5:134896937-134896959 AAAAAAAAGGAAAAAAAGGCTGG - Intronic
997571480 5:134931196-134931218 AAAAAAAAGAAAAAGAAGGCCGG - Intronic
997658208 5:135570588-135570610 AAAAATAAGGACAAATATGCTGG - Intergenic
997816768 5:137026804-137026826 AACAAAAAGGAACAGCAGGCTGG + Intronic
997938744 5:138137609-138137631 AAAAATAAAGAGAAAATGGCGGG - Intronic
998269799 5:140696273-140696295 AAAAATAAGGAGATTGTGGCTGG + Intronic
998338843 5:141398668-141398690 ATAATTAAGGAGAAACAGGATGG + Exonic
998664025 5:144275278-144275300 AAAAAAAAGGAGGAGCAGATGGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
998866276 5:146506065-146506087 AAAAAAAAGGATAAAAAGGCCGG - Intronic
999187881 5:149726393-149726415 AAAAAAAAGAAGGAGCAGTCCGG - Intergenic
999189048 5:149732728-149732750 TAAAATAAGGAGGAGCACACTGG - Intronic
999376615 5:151091176-151091198 AAAAAGAAGAAGAAGCAGAAAGG - Intronic
1000469777 5:161627109-161627131 AAAAATAAGGAGCCGAAGGAAGG - Intronic
1000586907 5:163111591-163111613 AAACATAAGAAGAAACATGCTGG + Intergenic
1000691321 5:164325393-164325415 AAATATAAGGAGATGAATGCTGG - Intergenic
1000811160 5:165863659-165863681 AAAAAAAAGGAGAAGCAGAAGGG - Intergenic
1001093193 5:168756579-168756601 AAGTTTAAGGAGAACCAGGCAGG - Intronic
1001185529 5:169567860-169567882 AAAAAAAAGGAGAAGAAGAGAGG - Intergenic
1001344117 5:170875241-170875263 AAACATAAAGAGCAGCAGGAGGG - Intronic
1001418997 5:171572670-171572692 GAAAGTAGGGAGAAGCAGGAGGG - Intergenic
1002041168 5:176515376-176515398 AAAAAAAAGAAAAAGCAGGCCGG - Intergenic
1002270161 5:178066511-178066533 AGAAAAAAGGTGAAACAGGCCGG + Intergenic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002357536 5:178642783-178642805 TGAGATAAGGAGAAGCTGGCTGG - Intergenic
1002622716 5:180500269-180500291 AAAAATAAGAAAAATCAGCCAGG - Intronic
1002655138 5:180739963-180739985 AAAAATAAAGACAAACAGGATGG + Exonic
1003052515 6:2792763-2792785 AAAATGAAAGAGATGCAGGCTGG - Intergenic
1003184807 6:3821482-3821504 AAAAAAAAATAAAAGCAGGCTGG + Intergenic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003476871 6:6491596-6491618 AAAAAGAAGGAGGAGCAAACTGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003679714 6:8240430-8240452 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004255236 6:14057733-14057755 AAAAATAAATAGAGGCAGGCAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1004580454 6:16946287-16946309 AAAATTAAGCCAAAGCAGGCAGG - Intergenic
1004727994 6:18329365-18329387 AAAAATAATGAGCATGAGGCAGG + Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005125480 6:22442220-22442242 GAAAAAAAGCAGAAGCAGGAAGG + Intergenic
1005261994 6:24070969-24070991 AAAAAGAAGAAGAAGAAGTCAGG + Intergenic
1005434840 6:25797842-25797864 AAAAATAGGGAGGACGAGGCGGG - Intronic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005700121 6:28392470-28392492 AAAGAAAAGGAGTAACAGGCTGG - Intronic
1005732711 6:28713978-28714000 AGAAATAATGAGAAGTAAGCCGG - Intergenic
1005966010 6:30726883-30726905 AAAAAAAAGGATAACTAGGCGGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006256496 6:32836880-32836902 AAAAATAGAGACAATCAGGCCGG + Intronic
1006638760 6:35478149-35478171 AAAAATAGAGGGATGCAGGCTGG - Intronic
1006645059 6:35510050-35510072 AAAAAAAAGAAAAAGAAGGCAGG - Intronic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006704461 6:36006585-36006607 AAATATAAGTAGAAACTGGCAGG + Intronic
1006953965 6:37850183-37850205 AAACATAACCAGAAGCAGGATGG + Intronic
1007006925 6:38372908-38372930 AAAAACATGGAGAAGCAAACAGG - Intronic
1007141097 6:39575563-39575585 AAAAATAAGAGGAAGCAGCCGGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007573644 6:42911016-42911038 AAAATTAAGAAAAAGTAGGCCGG - Intergenic
1007760540 6:44130911-44130933 AAAAAAAAGTAGTAGTAGGCAGG - Intronic
1007977068 6:46112758-46112780 AGAAATAAGAACAAGCAGGCTGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008439490 6:51516302-51516324 AAAAACAAGGAGAACCAGGAAGG - Intergenic
1008892469 6:56511013-56511035 AAAGATAAGGAGATAAAGGCTGG + Intronic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009297236 6:61967475-61967497 GAAAATAAGAAGCAGCAGGGTGG + Intronic
1010091721 6:71990666-71990688 AAAAGTGAGGAGAAGCAGTCTGG + Intronic
1010641252 6:78330771-78330793 AAAAAAAAAAAGAGGCAGGCTGG - Intergenic
1011164141 6:84426954-84426976 AAAAAAAAGTAAAAGCAAGCAGG + Intergenic
1011368349 6:86605425-86605447 AAAAACAAGATGAACCAGGCTGG + Intergenic
1011443267 6:87409507-87409529 AAAAAAAAGGCTAAGCAGGCTGG - Intronic
1011471664 6:87714025-87714047 AAATATAATCAGAGGCAGGCCGG - Intergenic
1011682884 6:89800129-89800151 AAAAAAAAGGAAAAACAGGCCGG + Intronic
1011765335 6:90613391-90613413 AAAAATAAGAATAATCAGGTGGG - Intergenic
1012160550 6:95880065-95880087 AAATCTAAGGAGAGACAGGCAGG + Intergenic
1012250408 6:96974015-96974037 AAAAAAAAAGAGAAGAAGTCAGG - Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012621689 6:101352583-101352605 AAAAGTGAGGAGAAGCAGTAGGG - Intergenic
1012674269 6:102095214-102095236 AAAAATCAAGAAAAGAAGGCTGG - Intergenic
1012930638 6:105312796-105312818 AAAAATGAGCAGAACCAGGATGG + Intronic
1012947348 6:105481655-105481677 AAAATAAAGCAGAAGCAGCCAGG - Intergenic
1013164283 6:107575731-107575753 AATAATAAGAAGAAGAAGACAGG + Intronic
1013210607 6:107983518-107983540 AAAAAAAAACAGAATCAGGCTGG + Intergenic
1013312084 6:108904656-108904678 AAAAAGAAGAAGAAGAAGGAAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013525262 6:110968283-110968305 AAAAATAAGTAAAATGAGGCCGG + Intergenic
1014155174 6:118101584-118101606 AAAAATAATGAGAAGTGGGATGG + Intronic
1014203386 6:118628496-118628518 GAAAATAAAGAGAAAAAGGCTGG + Intronic
1014209134 6:118689908-118689930 AAAAAAAAAAAAAAGCAGGCAGG - Intronic
1014562608 6:122909363-122909385 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1014605395 6:123467543-123467565 AAAAGAAAGGAGAAGCCAGCTGG + Intronic
1014616577 6:123608874-123608896 AAAAAAAAATGGAAGCAGGCTGG + Intronic
1014826725 6:126055367-126055389 ATAGTGAAGGAGAAGCAGGCAGG - Intergenic
1014889301 6:126823225-126823247 AAAAATAATGTGAAGCGGCCAGG - Intergenic
1015117040 6:129661190-129661212 AAAAAGAAGTGGAAGCAGCCAGG + Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1015981537 6:138844386-138844408 AAAAACAAAGAACAGCAGGCGGG - Intronic
1016055564 6:139574590-139574612 AAAAAAAAGCAGATGCTGGCGGG - Intergenic
1016239205 6:141908706-141908728 ATAAAGAAGGACCAGCAGGCAGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016477601 6:144445052-144445074 AAAAATAAGTAGATACTGGCCGG + Intronic
1016493523 6:144633526-144633548 AACAAAATGGAGAAGCAGGCCGG - Intronic
1016634381 6:146270830-146270852 AAAAAGAAAGAAAGGCAGGCAGG - Intronic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017757974 6:157545682-157545704 AAAAAAAAGTAGAAGGAGGGTGG + Intronic
1017944595 6:159084317-159084339 AAAAATAGAGAAAAGCAGGCTGG - Intergenic
1017999470 6:159566125-159566147 GAAAGTAGGGAGAGGCAGGCAGG + Intergenic
1018061657 6:160094389-160094411 AAAAGGATGGAGAAGCATGCTGG - Intronic
1018152281 6:160951526-160951548 AGAGATAAGGAGGAGCAAGCGGG + Intergenic
1018515894 6:164579781-164579803 TAAGATGAGGAAAAGCAGGCCGG - Intergenic
1018577582 6:165275978-165276000 AAAAAAAAAAAGAAGCAGGAAGG - Intergenic
1019231745 6:170571457-170571479 AAAAATAAGGAGAACAATTCTGG - Exonic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019680579 7:2346450-2346472 AAAAAAAAGGTGAGGCAGCCAGG + Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019978982 7:4606997-4607019 GAAAATAAAGAGAGGCTGGCTGG - Intergenic
1020126929 7:5538304-5538326 AAAAAAAAAGAAAAGCAGTCAGG + Intronic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020167933 7:5822962-5822984 AAACAAAAGGAAAAGCCGGCTGG + Intergenic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1020878977 7:13734898-13734920 AAAAGTAATCAGAAACAGGCTGG - Intergenic
1021061202 7:16115056-16115078 AAAAATAATTAGAATCAAGCAGG + Intronic
1021141751 7:17033974-17033996 TAAAATAAAAAGAGGCAGGCCGG - Intergenic
1021225819 7:18025096-18025118 AAAAAGAAGGTGGAGCAGGGGGG - Intergenic
1021443881 7:20711757-20711779 AGAAAGAAGGAAAGGCAGGCAGG - Intronic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022143223 7:27511722-27511744 TATAAAATGGAGAAGCAGGCTGG - Intergenic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1022303801 7:29127607-29127629 AAAAAACAGCAGAAGCAGGAAGG + Intronic
1022474565 7:30701502-30701524 AAAAACAAGGAGAGGAAGGTTGG - Intronic
1022519924 7:30999608-30999630 AAAAACAAAAAGAAACAGGCTGG + Intergenic
1022683060 7:32568159-32568181 AAAAAAAAGAATAAGCGGGCTGG - Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023264601 7:38392366-38392388 AAAAAAAAAAAGAACCAGGCCGG - Intronic
1023546109 7:41319076-41319098 AAAAATAAAGAGAGACAGGAAGG + Intergenic
1023922601 7:44641195-44641217 AAAAAAAAGAAGAAAAAGGCTGG - Intronic
1024539288 7:50463062-50463084 TAAAATAAGGAAGAGAAGGCCGG - Intronic
1025064624 7:55842614-55842636 AAAAAAAAGAAAAAGAAGGCTGG + Intronic
1025095223 7:56091218-56091240 AAAAATAAGACAAAACAGGCTGG + Intronic
1025253264 7:57365989-57366011 CAAAATAAGGCGAAGCAGCTGGG - Intergenic
1025940346 7:66072331-66072353 ATAAAGAAAGAGAAGCTGGCTGG - Intergenic
1026105864 7:67420297-67420319 AAAAAGAAGAAGAAGAAGACGGG - Intergenic
1026344649 7:69463775-69463797 AAAAAAAAACAGAAACAGGCTGG - Intergenic
1026851205 7:73724559-73724581 AAAAAAAAGAAGAAAAAGGCCGG - Intergenic
1027050941 7:75020783-75020805 AAAAATAAAAAAAATCAGGCTGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027766658 7:82352578-82352600 TAAAAGATGGAGATGCAGGCTGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028079682 7:86559591-86559613 AAGAATAAGAACAAACAGGCTGG - Intergenic
1028328416 7:89557740-89557762 AAAAAAATGAAGCAGCAGGCTGG + Intergenic
1028600378 7:92594207-92594229 AAAAAATAGGAAAATCAGGCTGG - Intergenic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029092872 7:98062071-98062093 CAAAAGAAGTAGAATCAGGCTGG - Intergenic
1029521299 7:101064361-101064383 AAAAAGAAGGAGCTGCAGGGTGG - Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029787898 7:102810879-102810901 AAAATTAATGAAAAGGAGGCTGG - Intergenic
1029838564 7:103338613-103338635 AAAAAAAAGAAGAGACAGGCTGG + Intronic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030035632 7:105406027-105406049 AAAAATAAGTTCATGCAGGCCGG - Intergenic
1030147167 7:106368353-106368375 AAAATTAGGGAGAGGCAGACAGG - Intergenic
1030249236 7:107423898-107423920 AAAAATAATGAAAAGAATGCAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030352680 7:108507356-108507378 AAAAAAAAAAAGAAACAGGCTGG + Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030900713 7:115120176-115120198 AAAAAAAAGAAGAAGAAGCCAGG + Intergenic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1030930898 7:115522151-115522173 AAATATAAGGGGAAGCTGCCAGG + Intergenic
1031080017 7:117249233-117249255 AAAAATCAGGGAAAGCAGTCTGG - Intergenic
1031245965 7:119311516-119311538 AAAAAAAAGAAGAAGAAGACTGG + Intergenic
1031333491 7:120496583-120496605 AAAAATACGAAAAAGCAGCCAGG - Intronic
1031984730 7:128156548-128156570 AAAAATCAGGACAATCAGCCAGG + Intergenic
1032081633 7:128861651-128861673 AAAAAAAAGGATCTGCAGGCTGG - Intergenic
1032098255 7:128950869-128950891 AAAAACCATGAGAAACAGGCGGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032253765 7:130280780-130280802 AAGAGCTAGGAGAAGCAGGCTGG - Intronic
1032329199 7:130962032-130962054 AAATAAAAGGAGAGCCAGGCTGG + Intergenic
1032346364 7:131120179-131120201 AAAAAAAAAAAGAAGCAGCCAGG + Intronic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033204471 7:139406044-139406066 AAAAACAAAAAGAAGAAGGCTGG - Intronic
1033342307 7:140501732-140501754 AAAAAAAAAAAGAAGCAGGATGG - Intergenic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1034290046 7:149923435-149923457 AAACACAAGGAGAAGCAAGCAGG + Intergenic
1034661022 7:152769411-152769433 AAACACAAGGAGAAGCAAGCAGG - Intronic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1035187383 7:157137232-157137254 AAAAATAAAAATAAACAGGCCGG - Intergenic
1035684087 8:1510202-1510224 AAAATTAAATAGAAACAGGCTGG + Intronic
1035815683 8:2537626-2537648 AGAAATGATGAGAAGTAGGCCGG - Intergenic
1035952818 8:4042829-4042851 AAAAAAAAAAAAAAGCAGGCTGG + Intronic
1036000090 8:4592680-4592702 AAAAATAAGGAAAAGAGGCCGGG - Intronic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037225486 8:16584628-16584650 GAAAATAAGGAGAAACGGCCAGG + Intergenic
1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG + Intergenic
1037314833 8:17591175-17591197 CAAAATAATCAGAAGCAGCCAGG - Intronic
1037445468 8:18961390-18961412 AAAAATAAATATATGCAGGCTGG + Intronic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1037765070 8:21767663-21767685 ACACGGAAGGAGAAGCAGGCAGG + Intronic
1038077038 8:24087919-24087941 AAAAAAAAGGAGAGGAAGGTGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038364653 8:26918916-26918938 CAAAAAAAGGAAAGGCAGGCCGG + Intergenic
1039062019 8:33579515-33579537 AAAAAAAAGGTTAAGCTGGCCGG - Intergenic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039825077 8:41166141-41166163 AAAAAAAAGAGAAAGCAGGCTGG - Intergenic
1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG + Intronic
1039973019 8:42336167-42336189 AAAGTTAAGGAGAAGCTGGTGGG + Intergenic
1040330698 8:46384321-46384343 AAGAAAACGGAGAAGCAGGGTGG + Intergenic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1042269051 8:66937425-66937447 AAAAATAAGTGGAAGCAGCCAGG + Intergenic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1043243424 8:77966212-77966234 AAAAAGAGAGAGAAGCAGGAAGG + Intergenic
1043317234 8:78937842-78937864 AAAAAAAAAAAAAAGCAGGCTGG - Intergenic
1043427141 8:80158643-80158665 AAAAAAAAAAAGAAGTAGGCCGG + Intronic
1044587895 8:93885052-93885074 AGAGAAAAGGAGAAACAGGCAGG + Intronic
1044983799 8:97740700-97740722 AAAAAAAAGAAAAATCAGGCCGG - Intergenic
1045424834 8:102055262-102055284 AAAAAGAAGAAGAAGCCGGTGGG + Intronic
1045509510 8:102803903-102803925 AAAAATAACTAAAAGAAGGCCGG + Intergenic
1045518683 8:102883957-102883979 AAAAAGACGAAGAAGCAGCCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045917307 8:107487263-107487285 AATAAAAAGGAGAGACAGGCCGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046160127 8:110351563-110351585 AAAAAAAAAAAGAAGAAGGCAGG - Intergenic
1046401304 8:113707640-113707662 AAAAGTAAGGTGAAGAAGGAAGG - Intergenic
1046604481 8:116355700-116355722 AAAAATAAAAAGAACCAGACTGG - Intergenic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1046934964 8:119876643-119876665 AAAAAAAAGAAGAAGAAGGATGG + Intronic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1046972995 8:120243509-120243531 AAAAATGATAAGCAGCAGGCTGG + Intronic
1047416907 8:124672196-124672218 AAAAATATGGAGAAGGGGCCAGG + Intronic
1047492731 8:125387816-125387838 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1047569065 8:126078031-126078053 AAAAATAAAGAGAAACAAGGCGG + Intergenic
1047591595 8:126332753-126332775 AAAAATAATGAGAAACTGGAAGG + Intergenic
1047661134 8:127038246-127038268 AAAGAGAAGGACAAGCAGCCAGG - Intergenic
1047727825 8:127699568-127699590 AAAAAGAACGAGATGCAGACAGG + Intergenic
1047989550 8:130271575-130271597 AGAAATAGGGAGATGCAGGTTGG - Intronic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048630847 8:136240723-136240745 GAAAATGAGCAGAAGCTGGCTGG - Intergenic
1048848457 8:138621384-138621406 AGAAAGAAGGAAAGGCAGGCTGG - Intronic
1049336440 8:142089181-142089203 AAAATCAAGGACAAGCAGTCCGG + Intergenic
1050607087 9:7313519-7313541 AAAAATAAAGAAAAGGGGGCTGG - Intergenic
1050684625 9:8153824-8153846 AAAAAAAAGGAGAACTATGCAGG + Intergenic
1050688495 9:8198929-8198951 AATAGGAAGGAGAAGCAGGAAGG + Intergenic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050731082 9:8710327-8710349 AAAAATAAGGCCATGCAGGGTGG + Intronic
1050786797 9:9413408-9413430 TAAAATAAGAAGCTGCAGGCCGG - Intronic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051302146 9:15663455-15663477 AAGAATAAAAATAAGCAGGCAGG - Intronic
1051428605 9:16959871-16959893 AAACAGAGGGAGAAGCAGGAGGG - Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051640567 9:19221071-19221093 AATAAAAAGCAGAACCAGGCTGG + Intergenic
1051702864 9:19843107-19843129 AAAAATAAAGATATGCAGCCAGG + Intergenic
1052002693 9:23306095-23306117 AAAAATAAAGAGAAGCACTTGGG - Intergenic
1052869973 9:33495150-33495172 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
1052946421 9:34172004-34172026 AAAAAAAAGGAGAAGAAGAAGGG - Intergenic
1053049502 9:34947810-34947832 AAAAATAAGAAAAAGTTGGCTGG + Intergenic
1053421466 9:37982494-37982516 AAAAAAATGGATAAGTAGGCCGG + Intronic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1054584436 9:66950768-66950790 AAAAAGAAGAAGAAGAAGCCTGG - Intergenic
1054916324 9:70498200-70498222 AGAAATAAAGAGAAAAAGGCAGG + Intergenic
1055415200 9:76074921-76074943 AAAAATAATATGATGCAGGCCGG + Intronic
1055692943 9:78853279-78853301 AAAAATATGAAGAAGAAGGTAGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056131577 9:83592481-83592503 CAAAATTAGTAGAAGTAGGCCGG + Intergenic
1056381776 9:86062709-86062731 AAAAAGGAGGAGAAGCAAACGGG + Intronic
1056477236 9:86964498-86964520 AAAACTAAGCAGAACAAGGCAGG - Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1056810760 9:89762188-89762210 ATATATTAGAAGAAGCAGGCTGG + Intergenic
1056847374 9:90052421-90052443 AAAAGTGAAGAGAAGAAGGCAGG - Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057493763 9:95543617-95543639 AAAAATTAGGTGAAATAGGCAGG + Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1057855838 9:98600116-98600138 AAAAATAAGAAGAACAAGGAAGG + Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058478556 9:105367122-105367144 AAAAATAAAGAAAAGAAGGAAGG - Intronic
1059133079 9:111775292-111775314 AAAAATAATTAAAAGTAGGCCGG - Intronic
1059138406 9:111829512-111829534 GAAGATAAGGAGAAGAAGGGAGG - Intergenic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059550043 9:115220097-115220119 AGAAAAAAGGGGAAACAGGCTGG + Intronic
1059704588 9:116809554-116809576 AAAAATATGGAAGAGCAGTCAGG - Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1060418463 9:123450053-123450075 AAAAAAAGGGAGATTCAGGCTGG + Intronic
1060586291 9:124788309-124788331 AAAAATAAAGAAACCCAGGCCGG + Intronic
1060596286 9:124851076-124851098 AAGAGTAAGGACAGGCAGGCAGG + Intergenic
1060620613 9:125062452-125062474 AAAAAAAAAGAAAAGCAGGCTGG + Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060649220 9:125310832-125310854 AAAAAAAAAAAGAAGAAGGCTGG - Intronic
1060840712 9:126791192-126791214 AAAAATCAGGAGGTACAGGCTGG + Intergenic
1060868496 9:127019620-127019642 AAAAATAATGAACAGCAGCCAGG - Intronic
1061053020 9:128207140-128207162 AAGAGTAAGGAGGAGCAGACTGG + Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061502121 9:131009855-131009877 AAAAATAAAGAAAAATAGGCCGG + Intronic
1061632470 9:131881783-131881805 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1061832649 9:133305225-133305247 AAAAAAAACAAGAAGGAGGCCGG + Intergenic
1062704304 9:137927231-137927253 AAAAAAAAGAAGAAGAAAGCTGG - Intronic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185582881 X:1224535-1224557 AAAAAAAAAGAAAAGCAGCCTGG + Intergenic
1185895407 X:3854163-3854185 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185900524 X:3892587-3892609 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185905640 X:3931018-3931040 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185984742 X:4819174-4819196 GAAAAAAGGGAGAAGCAGACAGG + Intergenic
1187165222 X:16798872-16798894 AAAAAAAAGGAAATGCTGGCTGG - Intronic
1187308589 X:18119548-18119570 AAAAAAAAGGAAAAGACGGCAGG + Intergenic
1187932368 X:24305219-24305241 AAAAAGAAGAAGAAGAAGTCAGG - Intergenic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1188118677 X:26277943-26277965 AAAAATCAGGTGAATCAGGTGGG - Intergenic
1188576645 X:31659342-31659364 TAAAAAAATGAGAAACAGGCCGG + Intronic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1188956677 X:36442095-36442117 AAATATAAGTGGAACCAGGCTGG + Intergenic
1189128244 X:38471173-38471195 AAAAATAAGGCCAAGCACGGTGG + Intronic
1189195171 X:39146740-39146762 AAAAATTTGGAGATGCAGCCTGG + Intergenic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189775243 X:44464722-44464744 AAAAAGAGGAAGAAGAAGGCAGG + Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189814859 X:44814336-44814358 TAAAAGTAGGATAAGCAGGCTGG - Intergenic
1189838266 X:45042467-45042489 AAAAATTAAGAGAAGCAAGATGG + Intronic
1190087640 X:47409637-47409659 AAAAAAAAAAAGAAGCTGGCTGG - Intronic
1190156664 X:47999081-47999103 AAAAAGAAGGAAATTCAGGCCGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190742067 X:53295620-53295642 AAAAAAAAGAAGAAGCAATCTGG + Intronic
1190803360 X:53813240-53813262 AAAAAAAAAAAGAAGCAGTCTGG + Intergenic
1190821972 X:53982001-53982023 AAAAATAAGAAAAAGTAGGGAGG + Intronic
1190883288 X:54508888-54508910 AAAAAAAAATAGAAGGAGGCTGG - Intergenic
1190913692 X:54794305-54794327 AAAAATTAAGCAAAGCAGGCTGG - Intronic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1192104493 X:68301148-68301170 AAAAATATGAACAAGCAGCCGGG + Intronic
1192121100 X:68456505-68456527 AAAAATAAGTGGAAGCAGCCGGG - Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192426269 X:71079623-71079645 ACAAATAAGAAAAACCAGGCCGG - Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1192497387 X:71625102-71625124 AAAAAAAAGGAGAATAAGCCAGG + Intergenic
1192700784 X:73469188-73469210 AAAAATTTGGAAAAGCAGTCAGG - Intergenic
1193022501 X:76805395-76805417 AGAAATAAGGAGAAAAAGGCAGG - Intergenic
1193578034 X:83227991-83228013 AAAAATAATAAGAAGAAGGAGGG - Intergenic
1193602240 X:83521531-83521553 AAAAATAAATAAAATCAGGCCGG - Intergenic
1193650532 X:84125556-84125578 AAAAATAAAGAGAAAAAGGCTGG + Intronic
1193995716 X:88364474-88364496 AAAAGTAATAAGAAGCTGGCAGG + Intergenic
1194071731 X:89332487-89332509 AAAAATATGGAGGTGCAGACAGG - Intergenic
1194116284 X:89902521-89902543 AAAAATAATCAGAAACAGGAGGG + Intergenic
1194209014 X:91046382-91046404 AAAAGACAGGAGAAGCAGGGAGG + Intergenic
1194220130 X:91179390-91179412 AAGAATAAGGACAGGCAGACTGG + Intergenic
1194695216 X:97039688-97039710 AGAAAGCAGGAGAAGCTGGCTGG - Intronic
1194871440 X:99137458-99137480 AAAAAAAAGGAAAAGCAGCAAGG - Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195512691 X:105735667-105735689 AAGAATAAGGCAAAGCAGGGTGG - Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1196731715 X:118947576-118947598 TAAATTATGGAGAATCAGGCTGG + Intergenic
1196883358 X:120220638-120220660 AAAGAAGAGGAGAAGCAGGGAGG + Intergenic
1196921157 X:120586542-120586564 AAAAATAGGAAGGAGGAGGCGGG + Intergenic
1197579866 X:128269064-128269086 AAAAATAACTAGAACCAGCCAGG + Intergenic
1197961979 X:132017031-132017053 AAAAAAAAGAAGAAGAAGGGAGG + Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198162362 X:134020281-134020303 AAACAAAAGGATAAGCAGGCCGG + Intergenic
1198202563 X:134436485-134436507 AAAAAAAAAAAAAAGCAGGCTGG - Intergenic
1198246037 X:134832697-134832719 AAAAAGAATGAGATCCAGGCTGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198727357 X:139691815-139691837 GAAAATAAAGAAAAGCCGGCCGG + Intronic
1198746669 X:139897939-139897961 AAAAAAAAGCAGCAGCAGCCAGG + Intronic
1198818521 X:140619159-140619181 AAAAATAAGTATAAGCAGCCAGG - Intergenic
1198825883 X:140697284-140697306 AAAAATTAGGTATAGCAGGCTGG - Intergenic
1199134530 X:144234810-144234832 AAAAAAAAGGAAATGTAGGCTGG + Intergenic
1199179398 X:144835816-144835838 AAAAATAGTTAGAAGTAGGCTGG + Intergenic
1199357476 X:146878588-146878610 AGAAATAAGGAGATGTAGCCAGG + Intergenic
1199406083 X:147462421-147462443 AAAAAAAAAGATAAGGAGGCTGG + Intergenic
1199850588 X:151722789-151722811 AGAAAGAAGGGGAAGCAGGGAGG - Exonic
1199991632 X:152990562-152990584 AAGAATAAGGAGAAGCCATCAGG - Exonic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200556642 Y:4643147-4643169 AAGAATAAGGACAGGCAGACTGG + Intergenic
1200725979 Y:6668215-6668237 AAAAATATGGAGGTGCAGACAGG - Intergenic
1200729777 Y:6721744-6721766 AGAATTAAGGAGAAGCAGTAAGG - Intergenic
1202626637 Y:56866569-56866591 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic