ID: 1179204463

View in Genome Browser
Species Human (GRCh38)
Location 21:39261532-39261554
Sequence ACATTTGTACTGATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179204463_1179204465 22 Left 1179204463 21:39261532-39261554 CCATGATCCATCAGTACAAATGT 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1179204465 21:39261577-39261599 TCTCAGTATTGTTATGAAGATGG 0: 1
1: 0
2: 0
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179204463 Original CRISPR ACATTTGTACTGATGGATCA TGG (reversed) Intronic
910073455 1:83247235-83247257 AAATTTATACTGGTTGATCATGG - Intergenic
911232721 1:95378003-95378025 ACATTTGTCCTAAAGGAGCAGGG - Intergenic
911611470 1:99962920-99962942 AAATGTCTACTGATGGATGAAGG + Intergenic
916456043 1:164971965-164971987 CTTTTTGTACTGATGGGTCAGGG + Intergenic
917084657 1:171293422-171293444 AGATTTGTACAGAAGGGTCATGG + Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921758522 1:218885342-218885364 AGATTTGTACTCTTGGACCAGGG + Intergenic
1063210859 10:3880112-3880134 ACATTGATTCTGTTGGATCAGGG + Intergenic
1063768275 10:9168288-9168310 AGATTTTTACTGATAGTTCAAGG + Intergenic
1068699416 10:60003991-60004013 AAATTGTTGCTGATGGATCAAGG - Intergenic
1069226165 10:65947622-65947644 ACATTTTTACACATGGACCAGGG - Intronic
1070348876 10:75572823-75572845 ACACTAGTACTACTGGATCAGGG - Intronic
1070799620 10:79237642-79237664 ACACTAGTTCTGATGGATTAGGG + Intronic
1074656830 10:115599481-115599503 ATAATTTTACTGATGCATCAAGG + Intronic
1080078952 11:28190830-28190852 ACATTTGTAATCATGGAATAAGG + Intronic
1080556458 11:33421772-33421794 ACACTGGTACTGATGTATGATGG - Intergenic
1080837203 11:35950204-35950226 GGAGTTGTACTGATGGATCTTGG + Intronic
1081451482 11:43174741-43174763 ACATTTGTGCTGCTGGCTTATGG - Intergenic
1081791394 11:45789089-45789111 ACATTGATCCTGCTGGATCAGGG - Intergenic
1088427220 11:109716969-109716991 TCATTTGAATTGATGTATCAAGG - Intergenic
1093632741 12:21429706-21429728 ACATTAGTACTTATGTTTCATGG - Intergenic
1094256636 12:28437132-28437154 ACACTTTTACTGATAAATCATGG - Intronic
1094344987 12:29457891-29457913 ACATTTGAGCTGATGCATAAAGG + Intronic
1095869250 12:47007798-47007820 ATATTTATACTGAAGGCTCAAGG + Intergenic
1096163758 12:49403130-49403152 ACATTAGTCCTGATGTCTCAAGG + Intronic
1100683221 12:96953372-96953394 ACATTTGTACTGAAGCATATAGG + Intronic
1109170621 13:59092838-59092860 AAATTTGTACAGATGTATCTAGG + Intergenic
1116774091 14:49159801-49159823 CCATCTTTGCTGATGGATCAGGG + Intergenic
1118179392 14:63476542-63476564 ATATTTGAACTGATTGAGCAGGG - Intronic
1119025999 14:71152696-71152718 ACATTTATACTGATGTAACTAGG - Intergenic
1119474832 14:74921167-74921189 CCATTTGTACTGAGTGAGCACGG - Intronic
1121928787 14:97953117-97953139 ACATTTCTCCTGATGGAATAAGG - Intronic
1122597863 14:102905560-102905582 ACACTCATGCTGATGGATCAGGG + Exonic
1124042779 15:26120270-26120292 TCGTTTGTTTTGATGGATCACGG + Intergenic
1130206760 15:81883452-81883474 ACTTTTGTTCTGAGGGATTATGG - Intergenic
1134071855 16:11265187-11265209 ACATTTGGGCTGAAGGAACAGGG - Intronic
1138883035 16:61039489-61039511 ACATTTGTTCTGATGTAAGATGG - Intergenic
1138902079 16:61285024-61285046 ATATTTGTACTGATGGTTCAAGG - Intergenic
1139161874 16:64519876-64519898 ACATTTGTGGTGACTGATCAGGG - Intergenic
1140869724 16:79095491-79095513 ACATTCTGACTGATGGACCAGGG - Intronic
1151275434 17:73030559-73030581 CCATTTCTCCTGCTGGATCACGG - Intronic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1155547794 18:26932750-26932772 ACAATGCTACTGATGGATCTGGG - Intronic
1155936685 18:31761972-31761994 ACATTTATACTGATTGATTTTGG + Intergenic
1156951242 18:42900995-42901017 GCATTTTTACTGATGGTGCAAGG + Intronic
1157622569 18:49024860-49024882 ACATCTGTCATGTTGGATCAGGG - Intergenic
1158023846 18:52872418-52872440 AGATTTGCACTGATGGAGCTGGG - Intronic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1159033808 18:63258181-63258203 ACACTTGTTCTGAAGGCTCAGGG - Intronic
1159578120 18:70204744-70204766 ACATTGGTATTTATGAATCACGG + Intronic
1161005136 19:1931864-1931886 TCATTTGGCCTGATGTATCATGG + Intergenic
927264605 2:21130855-21130877 TCATTTTTACTGCTAGATCAAGG - Intronic
930877319 2:56233395-56233417 ACATTTGTGTTGAAGAATCATGG + Intronic
933854769 2:86402549-86402571 ACATTTGTAATTATTGCTCATGG - Intergenic
934137559 2:89011225-89011247 ACTTTTATGCTGATGGACCATGG - Intergenic
935693439 2:105750276-105750298 ACATCTGTCCTGTTGGATGAGGG + Intronic
936409263 2:112240159-112240181 ACTTCTGGACTGATAGATCAGGG + Intronic
937450556 2:121998925-121998947 ACATTTGTTCAGATGCATCCGGG + Intergenic
940214173 2:151287717-151287739 ACATGTTTACTGATGTGTCACGG - Intronic
940598972 2:155833712-155833734 ACATTTGTAGTTTTGGATAAAGG - Intergenic
945476139 2:210284909-210284931 AAATTTGTACCCATGGAGCAAGG + Intergenic
1169282670 20:4280452-4280474 ACATTTGTACAGAAGGGTGAAGG - Intergenic
1173131474 20:40398083-40398105 AGATGAGTACTGAAGGATCAAGG - Intergenic
1173276433 20:41588181-41588203 ACATTTATCCTGCTGGATCCAGG - Intronic
1173842519 20:46167234-46167256 ACCTTTGTCCTCATGGCTCAAGG + Intergenic
1174774017 20:53326923-53326945 ACATCTGAACTTATGTATCACGG - Intronic
1175147460 20:56907690-56907712 TCATTTTGACTGGTGGATCAGGG - Intergenic
1177252346 21:18610954-18610976 ACATTTGAACTGGTGGCACAAGG + Intergenic
1177703757 21:24674025-24674047 ACATCTGTCCTATTGGATCAAGG + Intergenic
1177836838 21:26193937-26193959 ACTGTGTTACTGATGGATCATGG + Intergenic
1178816668 21:35936281-35936303 ACATTAGTCCTATTGGATCAGGG - Intronic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1181841071 22:25661702-25661724 ACTTTAGTACTGATGAATAAGGG + Intronic
1183024662 22:35055703-35055725 TCATATGTGCTGAAGGATCAGGG - Intergenic
953768529 3:45761847-45761869 ACTTATGTCCTGATGGATCATGG + Intronic
954250693 3:49365014-49365036 ACATTTGTAGAGGTGGGTCATGG - Intronic
957503723 3:81092556-81092578 AAATATGTATTGATGGATCCTGG + Intergenic
958708168 3:97683424-97683446 ACATCTGTACTAATGTATAAGGG - Intronic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
963727716 3:148940568-148940590 AGATTTGTACTTAAGGATGACGG + Intergenic
964674488 3:159262491-159262513 ACATGATTACTGTTGGATCATGG - Intronic
967131522 3:186475518-186475540 ATATTTGTGCTGATGGTGCAGGG + Intergenic
972935774 4:44132939-44132961 ACATTTGTACTGTTCAATAATGG - Intergenic
981154544 4:141418211-141418233 ACAATTGAACTCATGGAACATGG - Intergenic
985932799 5:3072318-3072340 ACATTAATACTGTTGGATCAGGG - Intergenic
986433511 5:7705215-7705237 ACAAGTTTACTAATGGATCAAGG - Intronic
987693309 5:21296602-21296624 ACATTTTTACTGATGGCGAAAGG - Intergenic
987899948 5:23998483-23998505 ACATTGGAAATCATGGATCAAGG - Intronic
988376856 5:30447397-30447419 ATATTAGAACAGATGGATCAAGG + Intergenic
989011928 5:36881620-36881642 ACATTTGTTCTTATGGATTCAGG + Intronic
991746968 5:69752954-69752976 ACATTTTTACTGATGGCGAAAGG + Intergenic
991750737 5:69802288-69802310 ACATTTTTACTGATGGCGAAAGG - Intergenic
991798570 5:70332896-70332918 ACATTTTTACTGATGGCGAAAGG + Intergenic
991826345 5:70628266-70628288 ACATTTTTACTGATGGCGAAAGG + Intergenic
991830026 5:70677185-70677207 ACATTTTTACTGATGGCGAAAGG - Intergenic
991890901 5:71332219-71332241 ACATTTTTACTGATGGCGAAAGG + Intergenic
991931470 5:71757000-71757022 ACAATTGTACTCATGGAGCTAGG + Intergenic
992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG + Intronic
993130196 5:83887157-83887179 AAATTTCTACTTATGTATCAGGG + Intergenic
995419191 5:111944212-111944234 ACAATTGTACTGATAAACCAAGG - Intronic
996464981 5:123789861-123789883 ACATTTCTTCTGATGGATCTGGG + Intergenic
999238630 5:150114719-150114741 ACATTTGTCCAGATGAAGCAAGG - Exonic
1002820409 6:719418-719440 ACATCAGTCCTGTTGGATCAAGG - Intergenic
1004042041 6:11988859-11988881 AAATTAGTACTGATGGTTAATGG - Intergenic
1004991839 6:21147003-21147025 ACATTATTGCTGATGGACCATGG - Intronic
1005212464 6:23482686-23482708 ATAGTTGTACCGATGGATTAAGG - Intergenic
1010079934 6:71848975-71848997 ACATTTGTATTATTGGATGATGG + Intergenic
1011845100 6:91553139-91553161 AAATTGGTACTGATGTAGCAGGG - Intergenic
1013146343 6:107397415-107397437 CCATTTGTACTGGTTCATCAAGG - Intronic
1015449823 6:133353504-133353526 ATATTTGTTCTGTAGGATCAAGG + Intronic
1015469287 6:133585471-133585493 ACATCTGTCCTGTTGGATTAGGG - Intergenic
1016889505 6:148992111-148992133 ACATTTGTGTGGATGGAGCAAGG - Intronic
1024362574 7:48483716-48483738 CTATTCCTACTGATGGATCAAGG - Intronic
1024980621 7:55154702-55154724 ACATTTGTACTGGTGGCTCCAGG + Intronic
1027291137 7:76712109-76712131 AAATTTATACTGGTTGATCATGG - Intergenic
1031880197 7:127189188-127189210 ACATTTGTAATGATGAGTGATGG - Intronic
1034378389 7:150666654-150666676 ACATTTGTACAGATGGAGCCAGG + Intergenic
1038903753 8:31873968-31873990 ACATTTTCATTGATGGATCAAGG - Intronic
1040681241 8:49812531-49812553 ACGTGTGTCCTGATGGCTCATGG + Intergenic
1040975456 8:53189306-53189328 ACATTTGTACTAATTTATAAAGG - Intergenic
1041531857 8:58877912-58877934 TCATTTGTTCTGATTGCTCAGGG + Intronic
1042435405 8:68758527-68758549 ACATTTGTTCTGAGAAATCAGGG + Intronic
1042526991 8:69773756-69773778 ACCTGTCTACTGATGAATCATGG - Intronic
1042689388 8:71480379-71480401 ACTTTTGTACTGTTGTATAAAGG - Intronic
1046840478 8:118850763-118850785 ACTTTTGTATTAATGGATTAAGG - Intergenic
1049596513 8:143486468-143486490 ACATTAGTCCTAGTGGATCAGGG + Intronic
1050807880 9:9704680-9704702 ATTTTTTTCCTGATGGATCAGGG - Intronic
1051370944 9:16358536-16358558 ACAGTTGTACTGGTTGATCTTGG - Intergenic
1051793433 9:20835572-20835594 ACATTGCTACTGATGTTTCAAGG + Intronic
1052777501 9:32747360-32747382 ACATTTTTACCAATGGCTCATGG + Intergenic
1055941397 9:81653562-81653584 TCTTTTGTACTTATGTATCAAGG - Intronic
1056653688 9:88491314-88491336 TCATTTGTACTGATGCCTGAAGG - Intergenic
1059732903 9:117074356-117074378 ACATTTGGTCTGAGGGATCAGGG + Intronic
1189928877 X:45986656-45986678 AGATCTGTACATATGGATCAAGG - Intergenic
1194242197 X:91464651-91464673 ACATGTGTTCTGAAAGATCAAGG + Intergenic
1196239717 X:113328581-113328603 ACATTTGTGGTGATGAAACAAGG + Intergenic
1197322187 X:125046151-125046173 ACATATGTATTGAAGGATGAAGG + Intergenic
1199842551 X:151664841-151664863 ACATTGGTACTGATGTTTCAAGG - Intronic
1201270728 Y:12251392-12251414 ACATTTGTACTGAAGCATTTTGG - Intergenic