ID: 1179209278

View in Genome Browser
Species Human (GRCh38)
Location 21:39312727-39312749
Sequence GCAAAGTGTGACCCGCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179209278_1179209303 21 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209303 21:39312771-39312793 GCGAGGGGAAGGGGCGGGGGCGG 0: 2
1: 0
2: 31
3: 601
4: 4013
1179209278_1179209299 17 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209299 21:39312767-39312789 CCCCGCGAGGGGAAGGGGCGGGG 0: 1
1: 0
2: 1
3: 54
4: 375
1179209278_1179209290 5 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209290 21:39312755-39312777 ACGGGCCGGGGTCCCCGCGAGGG 0: 1
1: 0
2: 0
3: 20
4: 129
1179209278_1179209291 6 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209291 21:39312756-39312778 CGGGCCGGGGTCCCCGCGAGGGG 0: 1
1: 0
2: 3
3: 12
4: 174
1179209278_1179209308 28 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209308 21:39312778-39312800 GAAGGGGCGGGGGCGGGGGGCGG 0: 1
1: 9
2: 109
3: 1067
4: 8164
1179209278_1179209296 15 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209296 21:39312765-39312787 GTCCCCGCGAGGGGAAGGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 276
1179209278_1179209306 24 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209306 21:39312774-39312796 AGGGGAAGGGGCGGGGGCGGGGG 0: 1
1: 6
2: 72
3: 875
4: 5122
1179209278_1179209293 10 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209293 21:39312760-39312782 CCGGGGTCCCCGCGAGGGGAAGG 0: 1
1: 1
2: 0
3: 10
4: 214
1179209278_1179209284 -8 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209284 21:39312742-39312764 CACTTTGCACCCCACGGGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1179209278_1179209297 16 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209297 21:39312766-39312788 TCCCCGCGAGGGGAAGGGGCGGG 0: 1
1: 0
2: 3
3: 38
4: 360
1179209278_1179209304 22 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209304 21:39312772-39312794 CGAGGGGAAGGGGCGGGGGCGGG 0: 1
1: 0
2: 17
3: 255
4: 2530
1179209278_1179209294 11 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209294 21:39312761-39312783 CGGGGTCCCCGCGAGGGGAAGGG 0: 1
1: 0
2: 0
3: 17
4: 169
1179209278_1179209301 18 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209301 21:39312768-39312790 CCCGCGAGGGGAAGGGGCGGGGG 0: 1
1: 0
2: 1
3: 42
4: 447
1179209278_1179209283 -9 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209283 21:39312741-39312763 ACACTTTGCACCCCACGGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 68
1179209278_1179209289 4 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209289 21:39312754-39312776 CACGGGCCGGGGTCCCCGCGAGG 0: 1
1: 0
2: 2
3: 25
4: 190
1179209278_1179209285 -7 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209285 21:39312743-39312765 ACTTTGCACCCCACGGGCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 48
1179209278_1179209305 23 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209305 21:39312773-39312795 GAGGGGAAGGGGCGGGGGCGGGG 0: 1
1: 2
2: 66
3: 712
4: 4301
1179209278_1179209307 25 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209307 21:39312775-39312797 GGGGAAGGGGCGGGGGCGGGGGG 0: 1
1: 5
2: 87
3: 860
4: 5869
1179209278_1179209295 12 Left 1179209278 21:39312727-39312749 CCCCAGTGCGGGTCACACTTTGC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1179209295 21:39312762-39312784 GGGGTCCCCGCGAGGGGAAGGGG 0: 1
1: 0
2: 1
3: 24
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179209278 Original CRISPR GCAAAGTGTGACCCGCACTG GGG (reversed) Intronic