ID: 1179209497

View in Genome Browser
Species Human (GRCh38)
Location 21:39313392-39313414
Sequence CCTGGCGCTCCCGGCTGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179209497_1179209513 28 Left 1179209497 21:39313392-39313414 CCGAAGCAGCCGGGAGCGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1179209513 21:39313443-39313465 CCGACTCGATGAGAGGCACCGGG 0: 1
1: 0
2: 1
3: 2
4: 57
1179209497_1179209509 21 Left 1179209497 21:39313392-39313414 CCGAAGCAGCCGGGAGCGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1179209509 21:39313436-39313458 GTCTTACCCGACTCGATGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 5
1179209497_1179209506 -8 Left 1179209497 21:39313392-39313414 CCGAAGCAGCCGGGAGCGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1179209506 21:39313407-39313429 GCGCCAGGGCGGGGGTGGCACGG 0: 1
1: 0
2: 2
3: 36
4: 480
1179209497_1179209511 27 Left 1179209497 21:39313392-39313414 CCGAAGCAGCCGGGAGCGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1179209511 21:39313442-39313464 CCCGACTCGATGAGAGGCACCGG 0: 1
1: 0
2: 0
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179209497 Original CRISPR CCTGGCGCTCCCGGCTGCTT CGG (reversed) Intronic
900532972 1:3163686-3163708 CCTGGGGCTGCCGGCATCTTTGG + Intronic
900947960 1:5841846-5841868 GCTGCCGCTGCCGGCTGCTGAGG - Intergenic
900993722 1:6109305-6109327 CTCGGGGCTCCCGGCTGGTTGGG - Intronic
901061516 1:6474021-6474043 CCAGGCTCTCCCGGCGGCTCTGG + Exonic
902384939 1:16071193-16071215 CCTGGAGCTGCAGGCTGCTGTGG - Intronic
903652435 1:24930135-24930157 CGTGGCTGTCCCGGCTGCCTGGG + Intronic
905124546 1:35707840-35707862 GCGGGCGCTCCCGGCAGCTGAGG + Intergenic
906479210 1:46189289-46189311 CCTGGGGCTCCCTCCTCCTTTGG + Exonic
906799816 1:48726918-48726940 CCTGGCTCCCCTGCCTGCTTTGG - Intronic
907332077 1:53678052-53678074 CCTGGCACCACCGGCTCCTTGGG + Intronic
907567144 1:55445841-55445863 CCTGGCTCTCCCAGCTGTCTTGG + Intergenic
908119317 1:60970980-60971002 CCTGCCGCCCCCAGCTGCTGTGG + Intronic
908356678 1:63329741-63329763 CCTGGGGCTCCCCGCTGCCTGGG + Intergenic
919728977 1:200900942-200900964 GCTGGCGCTCCAGGCTGCTTAGG - Exonic
921669189 1:217907456-217907478 GCTGGTGCTGCAGGCTGCTTGGG + Intergenic
1064908775 10:20377462-20377484 CCTGTAGTTCCCAGCTGCTTGGG + Intergenic
1065303490 10:24346693-24346715 CCTGGTGGTCCCAGCTACTTGGG - Intronic
1065435957 10:25703911-25703933 CCTGGTGGTCCCAGCTACTTGGG + Intergenic
1066352234 10:34646798-34646820 CCTGTGGGTCCCAGCTGCTTGGG - Intronic
1067477965 10:46578834-46578856 CCAGGGGCTCCCTGCGGCTTGGG - Intronic
1067616774 10:47762953-47762975 CCAGGGGCTCCCTGCGGCTTGGG + Intergenic
1067697666 10:48547554-48547576 CCTGGAGCACCTGTCTGCTTTGG - Intronic
1070079121 10:73168244-73168266 CCTGGCCCTCCCGCCGGCTCCGG - Exonic
1070396616 10:76016854-76016876 CCTGGCTCACACAGCTGCTTGGG + Intronic
1070800871 10:79243688-79243710 CCTGGCGCCCTCGGGGGCTTGGG - Intronic
1072169983 10:92849093-92849115 CCTGGCGCGCCGGGCTGCCGCGG + Intronic
1072562165 10:96586648-96586670 CCGGGCACTCCAGGCTGCGTGGG + Intronic
1073412109 10:103350894-103350916 ACGGGGGCTCCCGGCTGCTCCGG - Exonic
1075381865 10:122025696-122025718 CCTGTAGCTCCCAGCTACTTGGG - Intronic
1076696797 10:132251070-132251092 CCTGGGGCTCAGGGCTCCTTGGG - Intronic
1076801699 10:132833948-132833970 CCTGGCGTTCCCGGATGGGTGGG + Intronic
1077010432 11:376911-376933 CCTGGCCCTCCCGGCCCCCTTGG - Exonic
1077225248 11:1436696-1436718 GCTGGGGCTCCCAGCTGCTCCGG + Intronic
1078168527 11:8911145-8911167 CCTAGCGCTCCCGGCGGCGCCGG - Exonic
1078964640 11:16324057-16324079 ACTTGTGCTCCCAGCTGCTTGGG + Intronic
1083859859 11:65414298-65414320 CCTGTCGTGCCCAGCTGCTTGGG + Intergenic
1084674531 11:70626420-70626442 CCTGGTGCTCCTGGCTGATTTGG + Intronic
1084980645 11:72826854-72826876 CCTGGGGCTCCTGGCTGGTGGGG - Intronic
1088688109 11:112301868-112301890 CCTGGCTGTCCCAGCTACTTGGG - Intergenic
1089387838 11:118079642-118079664 CCTGACGCTTCCGGCTGCTCTGG + Intronic
1094635016 12:32217877-32217899 CCTGCTGCTCACGGCTGCTGAGG - Intronic
1095761171 12:45838640-45838662 CCTGTAGTTCCCAGCTGCTTGGG + Intronic
1096442450 12:51655504-51655526 CCTGGTGGTCCCAGCTGCTGGGG - Intronic
1098896230 12:76064042-76064064 CCTGTGGCTCCCAGCTACTTGGG + Intronic
1102101559 12:110281937-110281959 CCTGGCTCTCCCGGCCGCGCCGG - Intronic
1103094647 12:118122996-118123018 CCTGGTGATCAAGGCTGCTTGGG - Intronic
1103508226 12:121455414-121455436 CCTGGCGCCCTTTGCTGCTTTGG - Intronic
1103779458 12:123389271-123389293 CCCGGCCCTCCCGGCTGCGCGGG + Intronic
1104962775 12:132496001-132496023 CCCCTCCCTCCCGGCTGCTTGGG + Intronic
1105019152 12:132804923-132804945 CCTGCCGCTGCTGGCTGCTGTGG + Exonic
1110389632 13:74959296-74959318 CCTGACGCTCCACCCTGCTTCGG - Intergenic
1111950770 13:94707487-94707509 GCCGGCGCTCCCGGCCGCCTGGG - Intergenic
1116252416 14:42502992-42503014 CCTTGAGGTCCCAGCTGCTTGGG + Intergenic
1117038629 14:51750670-51750692 CTTGGCGCACCCGACTGCTGTGG - Intergenic
1121276327 14:92670485-92670507 CCTGGGGTTCCAGGCTGCTCAGG + Intronic
1122805063 14:104252358-104252380 CACGGCGTTCCTGGCTGCTTTGG + Intergenic
1125433792 15:39625117-39625139 CCTGCCTCACCCGGCTGTTTGGG - Intronic
1126852927 15:52809145-52809167 CCTGCCACTCCCTGCTACTTAGG - Intergenic
1127609202 15:60620808-60620830 CCTGGCGCTGATGGCTGCTGGGG + Intronic
1129659137 15:77543290-77543312 CCTGGCACTCCCCGAAGCTTTGG + Intergenic
1132459179 16:41824-41846 CCTGCCGCCCCCAGCTGCTCTGG - Intergenic
1132793799 16:1708298-1708320 CCTGGCACTCCAGGCTTCTGGGG - Intronic
1132947782 16:2541572-2541594 CCTGGCCCTCGCACCTGCTTGGG - Intronic
1135524641 16:23205225-23205247 CCTGGTGCTCCCGGTTGTTTAGG + Intronic
1136408767 16:30064751-30064773 CCAGGCTCTGCCGGCTCCTTCGG + Intronic
1136627618 16:31471915-31471937 CCTGGGGCTCCCTGCAGCTGAGG + Intronic
1138585891 16:57970290-57970312 CCTGGCTCTCGGGGCTGCCTGGG - Intronic
1141935389 16:87235000-87235022 CCTTTCGCTCCCAGCTGCCTAGG + Intronic
1142157937 16:88541116-88541138 CCAGCTTCTCCCGGCTGCTTGGG - Intergenic
1143767144 17:9145202-9145224 CCTGGTGCTCCTGGCTGCTGTGG - Intronic
1144264833 17:13558152-13558174 CCTGTAGCTCCTTGCTGCTTGGG + Intronic
1144656939 17:17042776-17042798 CCTGGCGCTCCCGGCGGGCTAGG - Exonic
1144812465 17:18009282-18009304 CCTGGTGGTCCCAGCTACTTGGG + Intronic
1146935162 17:36808578-36808600 CCCCGCGCCCCCGGCTGCCTCGG - Intergenic
1147140012 17:38455508-38455530 CCTGGAGCTGCCAGCTGCCTGGG - Intronic
1147399028 17:40168051-40168073 TCTGGCCATCCTGGCTGCTTGGG + Intronic
1148645930 17:49219709-49219731 CCTGGCGCCCCCGGGTGCTCAGG + Intronic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1150435717 17:65152652-65152674 CCTGTAGTTCCCAGCTGCTTGGG - Intronic
1150723569 17:67633818-67633840 CCTGGACCTCCCGGCCTCTTTGG + Intronic
1151530022 17:74698225-74698247 CCTGGCACTGCCAGCTGCTGAGG + Intronic
1151987421 17:77553014-77553036 CTTGGGGCTCCCTGCTGTTTTGG + Intergenic
1152613600 17:81328082-81328104 CCAGGCAGCCCCGGCTGCTTCGG - Intronic
1152891081 17:82882036-82882058 CCTGGGGCTCCTGGATGGTTGGG + Intronic
1154350609 18:13580245-13580267 CCTGGCCTTCCCTGCTGCTCTGG + Intronic
1161077682 19:2294314-2294336 CCTGCCTCTCCCGGCTTCCTGGG - Intronic
1161519184 19:4714053-4714075 CCGGGCCCTGCAGGCTGCTTGGG - Intronic
1161584512 19:5097918-5097940 CCTGGGGCCCCCAGCTTCTTTGG + Intronic
1162109031 19:8390391-8390413 CCTGGCGCTTCCGGCGGGATCGG - Exonic
1162808662 19:13151720-13151742 CCTGGGGCTCCAGCCTGCTCCGG + Intronic
1163824257 19:19514259-19514281 CCTGGCACCCACGGCTGGTTGGG + Exonic
1164109131 19:22138081-22138103 ACTGGGGCTCCCGGCTGCTCCGG + Intergenic
1165956996 19:39507305-39507327 GCTTGCGCTCCCGGCTACATGGG + Exonic
1166221733 19:41369380-41369402 CCTGGCCATCCCGGCTACTTTGG + Intronic
1166379469 19:42348356-42348378 CCTGGCCCTCCAGGCAGCATTGG - Exonic
1166992140 19:46698992-46699014 CCTGCGGCTTCAGGCTGCTTGGG + Intronic
1167649476 19:50721529-50721551 CCTGGGGCTCCCGGCAGCCGAGG + Intergenic
925159874 2:1676472-1676494 CATGGCGCTCCAGGCTCCTGAGG + Intronic
925714447 2:6771828-6771850 CCTGGTGTTCCTGGCTCCTTGGG - Intergenic
927134988 2:20090443-20090465 GCTGGCGCTCCAGTGTGCTTGGG - Intergenic
928282548 2:29961806-29961828 CCTGCATCTCCCAGCTGCTTTGG - Intergenic
931171217 2:59805502-59805524 CCTGGCTTTCCCACCTGCTTTGG + Intergenic
931463012 2:62464339-62464361 GCTGGAACTGCCGGCTGCTTTGG - Intergenic
932438352 2:71716477-71716499 CCTGGCCATGCAGGCTGCTTGGG - Intergenic
934039261 2:88114561-88114583 CCTTGTGGTCCCAGCTGCTTGGG - Intergenic
937870425 2:126782272-126782294 CCTTGCGCTCCCGTCCCCTTGGG - Intergenic
937946565 2:127343893-127343915 CCTGTAGCTCCCAGCTACTTGGG + Intronic
944413343 2:199462635-199462657 CCTGGCTCCCCCGGCAGCTCAGG + Intronic
948981449 2:241496886-241496908 CCTGGCGGTGCCGTGTGCTTTGG - Intronic
1168836593 20:881747-881769 CCTGGCACTCACGGCTGACTTGG - Intronic
1169160088 20:3370321-3370343 CCTGGAGCTCCAGGCTGCAGTGG - Intronic
1169227098 20:3863763-3863785 CCTGGCCATCCCGGAGGCTTGGG - Intronic
1175545526 20:59775504-59775526 CCTCCCGCTTCCTGCTGCTTTGG + Intronic
1175905674 20:62378229-62378251 CCTGGCTCTCCCAGCTCCTCAGG - Intergenic
1178384340 21:32137244-32137266 CCTGCCTCTCCCAGCTCCTTAGG - Intergenic
1179209497 21:39313392-39313414 CCTGGCGCTCCCGGCTGCTTCGG - Intronic
1179422825 21:41249788-41249810 CCTGGGTCTGCCGGCTGCTGAGG - Intronic
1180048437 21:45320476-45320498 CCTGGAGCTCCCTGCTGCATTGG + Intergenic
1181115992 22:20632841-20632863 CCTGCAGCTCCTGGCTGCTGTGG - Intergenic
1181320858 22:22005006-22005028 CCTGGCTCTCCCAGCTTCCTGGG - Intergenic
1181392785 22:22595589-22595611 CCAGGGCCTCCCGGCAGCTTTGG - Intergenic
1183541081 22:38429767-38429789 CCTGGCCCTGCCAGCTGCTGGGG - Intronic
1183780346 22:39995216-39995238 CCTGGCGCTCCGGGCTGGAGAGG - Exonic
1183932335 22:41242794-41242816 TCTGGAGGTCCCAGCTGCTTGGG - Intergenic
1183952329 22:41358672-41358694 CCTGGCCCTCCCAGCTGTCTGGG + Exonic
1184560484 22:45260196-45260218 CCTGGCTTTCCTGGCTGCTGTGG + Intergenic
1184999395 22:48235170-48235192 CCTGTCAATCCCAGCTGCTTGGG - Intergenic
1185052080 22:48559267-48559289 CATGGCGGTCGGGGCTGCTTGGG + Intronic
1185234578 22:49704649-49704671 CCGGGGGCTGCGGGCTGCTTGGG - Intergenic
1185248239 22:49784884-49784906 GCTGAGGCTCCCGGCTGCTCAGG + Intronic
1185317575 22:50185724-50185746 CCCGGCGCTCCCGGGTCCTAAGG - Intergenic
951640532 3:24830011-24830033 CCTGGCGCTACCCGCTCCCTAGG - Intergenic
953627252 3:44581065-44581087 CCTGGCGCTCCCGGCGGGCTAGG + Intronic
954641087 3:52098318-52098340 TCTGGTGCTGCTGGCTGCTTAGG + Intronic
960637104 3:119794812-119794834 CCTTGCGGTCCCAGCTACTTGGG + Intronic
960720690 3:120622343-120622365 CCTGCCTCTGCCAGCTGCTTAGG + Intergenic
961355781 3:126339150-126339172 CCTGACGGGCCCGGCTGTTTGGG + Intergenic
961454965 3:127019448-127019470 CCTTGTGCTCCCGCCTGCTGAGG + Intronic
961609435 3:128124769-128124791 CCTGGCTCTCCAGGCTGTTCCGG - Intronic
962029331 3:131582810-131582832 CCTGGCCATCCTGGCTGCTGAGG + Intronic
966860600 3:184229458-184229480 GCTGGCGCTCCCCCCTCCTTCGG - Intronic
966875240 3:184317753-184317775 CCTGGGGCTCCTGGCTGCACAGG - Exonic
968521848 4:1037719-1037741 CCTGGCCCACCTGGCTGCTCTGG + Intergenic
968585434 4:1414196-1414218 TCTGGCGCCACCGCCTGCTTGGG + Intergenic
969432865 4:7166117-7166139 GGTGGCGGTCCCGGCTGCATGGG + Intergenic
978534186 4:109743858-109743880 CATGGTGGTCCCAGCTGCTTTGG + Intronic
983893344 4:173054785-173054807 TCTGGTGCTCCAGGCTCCTTTGG - Intergenic
984972632 4:185204233-185204255 ACTGCTGCTCCCGGCTGCCTAGG + Exonic
985792186 5:1935274-1935296 CCTGGCGCTGCTGCCTGCTTTGG + Intergenic
986148459 5:5103543-5103565 CCAGCTGCTCCCGGCAGCTTGGG - Intergenic
989710346 5:44389526-44389548 CCTGGCGTTCCCAGCAGCCTAGG - Intronic
1001522958 5:172408011-172408033 GCTGGAGCTCCCGGCCTCTTTGG + Intronic
1002348278 5:178563229-178563251 CCTGCCACTCCCTGCTGCTTTGG + Intronic
1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG + Intronic
1007074710 6:39059104-39059126 CCAGGCTCTCCCTGCTCCTTGGG - Intronic
1007166594 6:39832779-39832801 CCTTGCTCTCTCTGCTGCTTGGG + Intronic
1008629747 6:53351901-53351923 GCGGGCGCTCCCAGCTACTTGGG - Intergenic
1016317317 6:142805208-142805230 CCAGGCCCTCCTGGCTCCTTTGG - Intronic
1017714183 6:157196654-157196676 CCTGGAGCTCCTGGATGCCTGGG + Intronic
1018415525 6:163599359-163599381 CCTGGAGCTCCAGGCTGGGTAGG - Intergenic
1019104468 6:169657113-169657135 CATGGCGGTCCCTGCTGCTGGGG - Intronic
1019129632 6:169864327-169864349 CCTGTCTCTCCCGGCTGCAGGGG - Intergenic
1019143025 6:169960181-169960203 CCTGGGGCCTCCTGCTGCTTGGG - Intergenic
1019383695 7:741474-741496 CCTGGCGCTCCCCTCTGCCGCGG - Intronic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1026167635 7:67924327-67924349 CCTGTAGGTCCCAGCTGCTTGGG + Intergenic
1027116559 7:75486057-75486079 CCTGGGGCTCCCGGCCCCTCTGG + Exonic
1034924861 7:155113087-155113109 CCTGCCTCTCCTGGCTGCTGCGG - Intergenic
1035477857 7:159156317-159156339 CCTGGTGCTCCCGCCTGCTGTGG + Intergenic
1035635830 8:1143576-1143598 CCGGGCTCTCCAGGCTGCCTGGG + Intergenic
1037333070 8:17763678-17763700 CCTGGGGCTCCAGGCTGGGTAGG - Intronic
1037888008 8:22605082-22605104 CCCGGCGCTGGCGGCTGCTGAGG + Intronic
1039278217 8:35955168-35955190 CTTGGCACTCCCGACTGCTGTGG - Intergenic
1049688544 8:143949008-143949030 CCTGGCTCTCTCTGCGGCTTTGG - Intronic
1049695690 8:143983398-143983420 CCGGGCGCTCAGGGCTGCCTTGG - Exonic
1051867379 9:21696718-21696740 CCGGGCGCTTCCGGCTGCTGGGG - Intergenic
1056764693 9:89437508-89437530 CCTGTCGCTGCCGCCTGCTAGGG - Intronic
1059349022 9:113651334-113651356 CCTGGGGCCCAGGGCTGCTTTGG + Intergenic
1061118519 9:128629272-128629294 CCTGCCGCCCTCGGCTGCTTGGG + Intronic
1061621624 9:131814510-131814532 CCTGGCGCTCTCAGCTGTCTTGG - Intergenic
1061744981 9:132733106-132733128 CCAGCCGCTCCAGGCTGCTGGGG - Intronic
1062261736 9:135666276-135666298 CCTGCCTCTTCCGGCTGCTGGGG + Intronic
1185445201 X:254187-254209 CCTGCCTCTCCCGGCTCCTGGGG + Intergenic
1185813546 X:3132542-3132564 CCTGCCTCTCCCGGCTCCTGGGG + Intergenic
1185873375 X:3682702-3682724 CCTGCCTCTCCCAGCTGCTGGGG - Intronic
1185875007 X:3694874-3694896 CCTGCCTCTCCCGGCTCCTGGGG - Intronic
1187046756 X:15655011-15655033 CCTGTCACTTCCGGCTGCTAAGG + Intronic
1189401367 X:40671944-40671966 CCTGATGTTCCTGGCTGCTTTGG + Exonic
1189621909 X:42850081-42850103 ACTGGCAATCCCTGCTGCTTTGG + Intergenic
1194744827 X:97617032-97617054 CCTGGCCTTCCTGGCTGCTCAGG - Intergenic
1195881729 X:109600238-109600260 CCTGCCTCTCCGCGCTGCTTAGG - Intergenic