ID: 1179209563

View in Genome Browser
Species Human (GRCh38)
Location 21:39313634-39313656
Sequence GACCGACGCCTCCGCGGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179209547_1179209563 19 Left 1179209547 21:39313592-39313614 CCGCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209548_1179209563 16 Left 1179209548 21:39313595-39313617 CCGCCGCCGCCGCCGCCGCCATA 0: 1
1: 36
2: 272
3: 2144
4: 3448
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209549_1179209563 13 Left 1179209549 21:39313598-39313620 CCGCCGCCGCCGCCGCCATACCG 0: 1
1: 2
2: 23
3: 257
4: 1372
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209550_1179209563 10 Left 1179209550 21:39313601-39313623 CCGCCGCCGCCGCCATACCGTGC 0: 1
1: 0
2: 2
3: 27
4: 183
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209555_1179209563 -2 Left 1179209555 21:39313613-39313635 CCATACCGTGCGCGCCGCCTGGA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209552_1179209563 4 Left 1179209552 21:39313607-39313629 CCGCCGCCATACCGTGCGCGCCG 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209553_1179209563 1 Left 1179209553 21:39313610-39313632 CCGCCATACCGTGCGCGCCGCCT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209551_1179209563 7 Left 1179209551 21:39313604-39313626 CCGCCGCCGCCATACCGTGCGCG 0: 1
1: 0
2: 0
3: 8
4: 48
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77
1179209556_1179209563 -7 Left 1179209556 21:39313618-39313640 CCGTGCGCGCCGCCTGGACCGAC 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG 0: 1
1: 0
2: 2
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179209563 Original CRISPR GACCGACGCCTCCGCGGGGG AGG Exonic
903016655 1:20366211-20366233 GGCCGCCGCCTACGCGGGTGGGG + Intergenic
904485939 1:30824608-30824630 GGCCGGCGCCCCCGCCGGGGCGG + Intergenic
904973942 1:34441719-34441741 GGCCGGCGGCTCCGCAGGGGAGG + Intergenic
907091497 1:51729770-51729792 GGGCGACCCCTCCGCCGGGGAGG + Intronic
908523394 1:64966129-64966151 GCCCGCCGGCTCCGCGGGGCTGG + Intronic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1069581882 10:69572239-69572261 GGCCCAGGCCTCCACGGGGGCGG - Exonic
1079163168 11:18012960-18012982 GAGCGCGGCCGCCGCGGGGGCGG + Exonic
1080628522 11:34052171-34052193 AGCCGGCGGCTCCGCGGGGGAGG + Intronic
1085050511 11:73377694-73377716 GACTGAGGCCTGCGCGGGGGAGG - Intronic
1091259775 11:134224940-134224962 GACAGCCGGCTCCACGGGGGAGG - Exonic
1091823171 12:3491303-3491325 CCCCGAAGCCTCCGCGGCGGCGG - Exonic
1092820616 12:12350338-12350360 GCCCGGAGCCTCCGCGGGGAGGG - Exonic
1096460715 12:51820389-51820411 CCCCGCCGCCTCCGCGTGGGAGG - Intergenic
1100329692 12:93571712-93571734 GACCGCCGCCTCCGAGCGCGGGG + Exonic
1104912299 12:132245116-132245138 GCCTGACTCCTCCGCGGGGCAGG - Intronic
1104918580 12:132278946-132278968 GGCAGAAGCCTCCCCGGGGGCGG - Intronic
1112050620 13:95641771-95641793 GGCCGCCGCCGCCGCGGGTGCGG - Exonic
1118220968 14:63853767-63853789 GCCTAGCGCCTCCGCGGGGGCGG + Intronic
1121710982 14:96039232-96039254 GACGGACCCCGCCCCGGGGGTGG + Intergenic
1122603011 14:102930513-102930535 GACCGGGGCCTCCTCGGGGCCGG + Intronic
1125594233 15:40874063-40874085 GCGCTACGCCGCCGCGGGGGAGG + Exonic
1132398244 15:101489589-101489611 CACCGACACCGCCGCGGGCGCGG - Exonic
1132608048 16:801663-801685 GGCCCACGCTTCCCCGGGGGTGG - Intergenic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1133218523 16:4307840-4307862 GGCCCAAGCCTCCGCCGGGGCGG - Intergenic
1135707411 16:24686742-24686764 GACAGAGGCCTCTGCAGGGGTGG + Intergenic
1139678116 16:68539385-68539407 AACCGAGGCTTCGGCGGGGGCGG + Exonic
1139806177 16:69566570-69566592 GGCCGGCGGCTCCGCGGGGGAGG - Intronic
1152654946 17:81515013-81515035 GCCCGGCGCCTCCGAGGGGTCGG + Intronic
1160508883 18:79442309-79442331 GACCGACGCCTCGGCGAGGGTGG - Intronic
1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG + Intergenic
1161606642 19:5218752-5218774 GCCTGAAGCCTCCACGGGGGAGG + Intronic
1162125680 19:8498474-8498496 GGCAGAGGCCTCCGCCGGGGTGG + Exonic
1162311343 19:9909248-9909270 GACCGTCGCCTCTGCCTGGGGGG - Intronic
1162951368 19:14073633-14073655 GAGCGGCTCCTCGGCGGGGGCGG + Exonic
1163635068 19:18433837-18433859 GCCCGACGCCGCCGCGGGGGGGG - Intronic
1165068454 19:33241865-33241887 CTCCGACCCCTCCCCGGGGGCGG - Intergenic
1167272069 19:48511442-48511464 CAGCGAGGCCGCCGCGGGGGTGG + Intronic
927488447 2:23504930-23504952 AACCGAAGCCTCCACGGGGCAGG + Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
929604670 2:43226563-43226585 TGCCGTCGGCTCCGCGGGGGGGG - Exonic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
948993170 2:241564763-241564785 GGCCGACGCCGGCGCGTGGGTGG + Intronic
1173279683 20:41617854-41617876 GAGCAACTTCTCCGCGGGGGCGG + Intronic
1173843615 20:46174658-46174680 GACCTACGCCTTCGAGGGCGCGG - Exonic
1176286031 21:5020250-5020272 GGCCGAGGCGGCCGCGGGGGAGG - Intergenic
1178327893 21:31660053-31660075 GACCGAGGCCGCCGCGGGGCTGG + Intronic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1179871150 21:44243225-44243247 GGCCGAGGCGGCCGCGGGGGAGG + Intergenic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1183080490 22:35452718-35452740 GTCCGACTCCTCCGCTGGGGTGG + Intergenic
1184184779 22:42857259-42857281 GAGCGACGAGGCCGCGGGGGCGG + Exonic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
966863163 3:184241750-184241772 CACCGAGGCCTCCGAGGGGGCGG + Exonic
968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372739 4:10939-10961 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG + Intergenic
969714575 4:8862046-8862068 GGGCGTCGCCTCCGCTGGGGAGG - Intronic
985462652 4:190121598-190121620 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462662 4:190121656-190121678 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462667 4:190121685-190121707 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462672 4:190121714-190121736 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462677 4:190121743-190121765 GACGGACGCCGCCGCGGCGCAGG - Intergenic
1002000610 5:176194597-176194619 GACCGGCGGCTCTGCGGGGCGGG + Intergenic
1002187119 5:177459570-177459592 GCCCCAGGCCTCGGCGGGGGTGG - Intronic
1002253729 5:177944384-177944406 GACCGGCGGCTCTGCGGGGCGGG - Intergenic
1002281100 5:178130693-178130715 GGCCGACGCCTCTGCCGGGTGGG + Intergenic
1007172300 6:39872358-39872380 GGCCGATGCCTTCCCGGGGGAGG - Intronic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1020037664 7:4974442-4974464 GCCCGAGGCCGCCGCGGAGGCGG + Intergenic
1020162154 7:5781182-5781204 GCCCGAGGCCGCCGCGGAGGCGG - Intronic
1032122873 7:129169356-129169378 GGCCTAGGCCGCCGCGGGGGCGG - Intronic
1037450751 8:19013861-19013883 GGCCGACGCCTCGGGGAGGGGGG + Intronic
1037535222 8:19817431-19817453 CGCCGCCGCCACCGCGGGGGAGG - Exonic
1038147698 8:24913680-24913702 GGCCGCCGCCTCCACGGGGCGGG + Exonic
1041304641 8:56446752-56446774 CGCCGACGCCTTCGCGGGAGGGG + Intergenic
1043428461 8:80171564-80171586 GCCCGACGCCTCTGGGGGTGGGG - Intronic
1044306405 8:90645754-90645776 GACCGCCTTCCCCGCGGGGGCGG - Exonic
1051287390 9:15510767-15510789 GAGCGACGCCACCGAGGGGGGGG + Intronic
1053452137 9:38202286-38202308 GAGTGAGGCCTCAGCGGGGGTGG + Intergenic
1062400425 9:136370286-136370308 GCCCGACGCCTCCGGGTAGGAGG - Exonic
1190055967 X:47181243-47181265 GACCGGCGGCTCCTCGGAGGTGG - Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic
1201465618 Y:14277227-14277249 GACAGATGCCTCCACTGGGGAGG - Intergenic