ID: 1179209721

View in Genome Browser
Species Human (GRCh38)
Location 21:39314212-39314234
Sequence GACCCGCGCTCCTGGGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179209707_1179209721 8 Left 1179209707 21:39314181-39314203 CCGCGCCTCCCGCAGAGGGGAAC No data
Right 1179209721 21:39314212-39314234 GACCCGCGCTCCTGGGGCGGGGG No data
1179209708_1179209721 3 Left 1179209708 21:39314186-39314208 CCTCCCGCAGAGGGGAACGCCGC No data
Right 1179209721 21:39314212-39314234 GACCCGCGCTCCTGGGGCGGGGG No data
1179209710_1179209721 -1 Left 1179209710 21:39314190-39314212 CCGCAGAGGGGAACGCCGCCCGG No data
Right 1179209721 21:39314212-39314234 GACCCGCGCTCCTGGGGCGGGGG No data
1179209709_1179209721 0 Left 1179209709 21:39314189-39314211 CCCGCAGAGGGGAACGCCGCCCG No data
Right 1179209721 21:39314212-39314234 GACCCGCGCTCCTGGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179209721 Original CRISPR GACCCGCGCTCCTGGGGCGG GGG Intronic