ID: 1179213486

View in Genome Browser
Species Human (GRCh38)
Location 21:39347877-39347899
Sequence ACAGTTTCCAAGCCAACTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179213486_1179213489 17 Left 1179213486 21:39347877-39347899 CCCGAAGTTGGCTTGGAAACTGT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1179213489 21:39347917-39347939 CGTTCCCTTTCTCCTGGCCTCGG 0: 1
1: 0
2: 2
3: 31
4: 284
1179213486_1179213488 11 Left 1179213486 21:39347877-39347899 CCCGAAGTTGGCTTGGAAACTGT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1179213488 21:39347911-39347933 CTTACACGTTCCCTTTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179213486 Original CRISPR ACAGTTTCCAAGCCAACTTC GGG (reversed) Intronic
900330450 1:2131719-2131741 GCAGTAACCAATCCAACTTCAGG - Intronic
901503493 1:9668989-9669011 ACAGTCACCAAGACAAATTCTGG - Intronic
903752882 1:25639585-25639607 ATAGTTTCCTAGCCAACCGCAGG - Intronic
910051347 1:82977827-82977849 ACAGTCTACATGCCAACATCCGG - Intergenic
910962205 1:92774912-92774934 ACACTTTGCAAGCAAACTTAGGG + Intronic
912002574 1:104853556-104853578 AAAGTTTTCAAGGCAACTTGAGG - Intergenic
918338395 1:183545201-183545223 ACAGTCTACAAGCCAGCTGCAGG + Exonic
920759199 1:208765642-208765664 ACAGATTCCTAACCAACTGCTGG - Intergenic
921857820 1:220007313-220007335 ACAGGCTTCAAGCCAACCTCAGG + Exonic
921865038 1:220079883-220079905 TTAGTTTCAAAGCCAACTACTGG + Intronic
922083589 1:222323740-222323762 AATCTTTCCAAGCCAATTTCAGG + Intergenic
922740233 1:228010346-228010368 CCAGGGTCCAAGCCCACTTCAGG + Intronic
924191039 1:241552871-241552893 ACAGTTTCCAGGGCAATTTGGGG - Intronic
1065551160 10:26869617-26869639 AAAGTTCCCACGCCAACCTCAGG - Intergenic
1067211760 10:44265426-44265448 TCAGTTTCCAAGCTCAGTTCAGG - Intergenic
1068762501 10:60728777-60728799 AAAGGTTCCAATCCAATTTCAGG + Intronic
1072047526 10:91671869-91671891 AGAGTTTACAAACCACCTTCAGG - Intergenic
1072755551 10:98018556-98018578 CCAGTTTCCAGGCCCAATTCAGG - Intronic
1074155560 10:110795857-110795879 ACAGTTTGGAAGCCAACATTTGG - Intronic
1075275199 10:121086731-121086753 ACATTTCCCAGGCCAACCTCTGG + Intergenic
1076087368 10:127646253-127646275 ACAGTTACCAAGGCAATTTTGGG + Intergenic
1077702038 11:4451428-4451450 ATAATTTCCAAGCCTATTTCAGG + Intergenic
1079394619 11:20050996-20051018 ACAGATTCAAAGCAAAATTCAGG - Intronic
1081223843 11:40496871-40496893 TCAGTTTCCTAACCAATTTCAGG + Intronic
1081714335 11:45237879-45237901 TCAGTTTCCATGGCAACGTCTGG + Intergenic
1082529015 11:54083985-54084007 GCAGTTTCCAAACCCACTTTCGG + Intergenic
1087827115 11:102778091-102778113 AGTGTTTCCAAGCCAATTTAGGG + Intronic
1088365342 11:109034471-109034493 ACACTTTCCTAGCCATCTTTGGG - Intergenic
1091995937 12:4994124-4994146 ACAGGTTCCCAGCTAACTCCTGG - Intergenic
1094217069 12:27953927-27953949 ACAGTTCCCAACCCAACATCAGG - Intergenic
1095351624 12:41220615-41220637 ACACTATCCAAGTCAGCTTCTGG - Intronic
1095707176 12:45249842-45249864 ACAATTTCAAAGACAAGTTCTGG - Intronic
1097655656 12:62359212-62359234 ACAGTTTGAAAGCCAAAGTCTGG + Intronic
1101117006 12:101541737-101541759 ACCGTTGCCTAGGCAACTTCAGG + Intergenic
1105214565 13:18276770-18276792 ACAGATTCCAACTCCACTTCTGG - Intergenic
1106740144 13:32631808-32631830 ACAGTTTAGAACACAACTTCAGG - Intronic
1107165283 13:37276304-37276326 AGAGTTTCCATGCCAAGGTCAGG + Intergenic
1109360819 13:61292909-61292931 ACATTTTCCAGCTCAACTTCAGG + Intergenic
1110001445 13:70208025-70208047 ACAGTTTTCCAGCCAACTTTTGG - Intergenic
1112563772 13:100535038-100535060 ACAGTTTCCAAGTTCTCTTCTGG - Intronic
1115194279 14:30779034-30779056 AGAATTTCCAAGCCACCTTTAGG - Intergenic
1116641060 14:47463659-47463681 TTAATTTCCAAGCAAACTTCTGG + Intronic
1123182975 14:106486977-106486999 ACTTTTCCCAAGCCCACTTCAGG + Intergenic
1124693245 15:31843207-31843229 ACAGTTACCTCCCCAACTTCTGG + Intronic
1126273746 15:46851037-46851059 ACAGTTCCCAAAGCAACTTGTGG + Intergenic
1127209674 15:56760310-56760332 ACCATTGCCAAGACAACTTCAGG + Intronic
1127343475 15:58069507-58069529 ACAGTTTCTTAGCCAAATTGGGG - Intronic
1131469870 15:92687485-92687507 ACTGATTCCAAGTCAATTTCTGG - Intronic
1131831857 15:96359718-96359740 ACAGTCTCCTCGCCAACTTCGGG - Intergenic
1138338283 16:56269789-56269811 ACAGTTTCCCCCCCAACTTCTGG - Intronic
1141108086 16:81249938-81249960 ACAGTTTCCAAGCGCCCCTCTGG - Intronic
1142793108 17:2284150-2284172 AAAGTTTCCGAGTCAACTCCTGG - Intronic
1149650196 17:58271794-58271816 TCAGTTTCCTCGCCAATTTCAGG + Exonic
1150485438 17:65540067-65540089 GCAGGTACCAAGCCAAGTTCTGG + Intronic
1150820312 17:68429489-68429511 AAAATTCCCATGCCAACTTCTGG + Intronic
1152237319 17:79145355-79145377 AAAGCTTCCAAGGCAATTTCAGG - Intronic
1153489373 18:5631056-5631078 ACAGCCTCCAAGCCACTTTCTGG - Intergenic
1154094500 18:11399359-11399381 ACAGTGTCCAAACACACTTCTGG + Intergenic
1155536810 18:26827200-26827222 ACAGTTTCCATGGCAACATTTGG + Intergenic
1155678117 18:28455334-28455356 CCAGTTTCCAAACCTACTTTTGG + Intergenic
1156285905 18:35695629-35695651 ACAGTTACTAAGGCTACTTCAGG + Intronic
1158586981 18:58747960-58747982 ACTGTTTCATAGCAAACTTCAGG + Exonic
1159049257 18:63402770-63402792 GCAGTTTACTACCCAACTTCAGG - Intronic
1159195039 18:65102312-65102334 ACTTTCTCCAAGCTAACTTCTGG + Intergenic
1159678396 18:71315535-71315557 ACATTTTCAAAGCCAAAATCTGG + Intergenic
1164427876 19:28158746-28158768 AAAATTTCCAAGCCAACTCTGGG + Intergenic
925174016 2:1769831-1769853 GCAGCTTCCAAGTCAACCTCGGG - Intergenic
931100273 2:58991567-58991589 ACAGTTGCCATGGCAACATCAGG - Intergenic
933747537 2:85581970-85581992 ACAGTTTCCCAGCCACATGCTGG - Exonic
934938721 2:98484063-98484085 AGAGATTCCAAGCCCACCTCTGG - Intronic
938906492 2:135841672-135841694 AAAGTGTCCAATCTAACTTCAGG - Intronic
940788917 2:158011403-158011425 ACAGTTTCCAGGCTCACATCTGG + Intronic
942484580 2:176425655-176425677 GCATATTCTAAGCCAACTTCAGG + Intergenic
1170717127 20:18841404-18841426 ACAATTTCCATGACAACTCCTGG - Intergenic
1170907856 20:20531725-20531747 ACAGTGTACAAGCCACCCTCAGG - Exonic
1171805410 20:29674664-29674686 TCAGTTACCAAGTCCACTTCTGG - Intergenic
1172588312 20:36100368-36100390 AGAGTCTCCAGGCCCACTTCAGG + Intronic
1175667193 20:60870779-60870801 ACAGCTTCAGAGCCAACTGCAGG + Intergenic
1177969605 21:27772874-27772896 AAAGTTGCCAAGTCAACTTATGG - Intergenic
1178034761 21:28567487-28567509 AAAGTTTCTAAGCTAACTTTAGG - Intergenic
1179213486 21:39347877-39347899 ACAGTTTCCAAGCCAACTTCGGG - Intronic
1181146116 22:20848482-20848504 ACAGTATACTAGCCAACATCAGG + Intronic
1181390149 22:22574374-22574396 ACAGTCTCCAAGCCACATTTAGG - Intergenic
1183929978 22:41230326-41230348 TCAGTCTCCAAGCCAAAGTCAGG - Exonic
951754196 3:26071708-26071730 TCAGTTTCAAAGCCCACTTCTGG + Intergenic
952073495 3:29668585-29668607 ACACTTTTCCAGCTAACTTCTGG - Intronic
952470568 3:33646591-33646613 ACTGTTTCCATGGGAACTTCTGG - Intronic
953192150 3:40698103-40698125 CCAGTTTCTAAGCCAAAATCGGG - Intergenic
953609659 3:44437154-44437176 ACAGTTGCCATGGCAACATCAGG - Intergenic
955204978 3:56887670-56887692 ACAGGTTCCCAGCCAATTTGAGG + Intronic
959033132 3:101326489-101326511 GCATTCTCCAAGCCGACTTCTGG + Intronic
959486412 3:106932109-106932131 ACATCTCCCAAACCAACTTCTGG + Intergenic
961503586 3:127355389-127355411 ACTGTTTCCATGGCAACATCTGG - Intergenic
961681384 3:128602606-128602628 ACATTTTTCAAGCCCACTTTGGG - Intergenic
968059844 3:195719221-195719243 ACAGTTTGCAGGTCAACCTCAGG - Intergenic
971092898 4:23365434-23365456 CCAGTCTCCAAATCAACTTCTGG + Intergenic
975872355 4:78794415-78794437 ACAGTTTCTAAGTCTACTTTTGG - Intronic
978223498 4:106305850-106305872 ACAAATTCCAAGGCAACGTCAGG + Intronic
978345715 4:107766521-107766543 ACAGATTCAAAGCCATTTTCAGG + Intergenic
979801614 4:124916225-124916247 ATATTATCCAAGCAAACTTCAGG - Intergenic
981089310 4:140716162-140716184 ACAGGTTTCAAGCTATCTTCAGG - Intronic
981286307 4:143023284-143023306 ACAGATTCCAAGGCAAGGTCTGG - Intergenic
983116478 4:163823545-163823567 ACAATTTCCTAACCAAATTCAGG + Intronic
983195857 4:164806036-164806058 AGTGCTTCCAACCCAACTTCAGG + Intergenic
985191965 4:187384081-187384103 ACCTTTTCAAAGCCAACTTTTGG - Intergenic
985491330 5:181471-181493 ACAGTTTCCAAAGCAACTCGGGG - Intronic
990701436 5:58479005-58479027 TCAGGTTCCAAGCCAACTGTTGG - Intergenic
992360041 5:76028134-76028156 ACAGTTTCCAAGCCATGATGCGG - Intergenic
997258811 5:132449727-132449749 ACAGTTTCCAAGGCTACGTTGGG - Intronic
997341147 5:133145586-133145608 CCAGTATCCAAGACAGCTTCCGG + Intergenic
999550276 5:152678942-152678964 ACAGTTTCCAATGCTAATTCAGG - Intergenic
999866202 5:155702919-155702941 ATAGCTTCCAAGCCAAATCCAGG - Intergenic
1001755891 5:174168147-174168169 ACAGTTTCGCATCCATCTTCTGG + Intronic
1002184332 5:177447173-177447195 ACCGTTTCCAAGCGAACTGGTGG - Intronic
1006578289 6:35061639-35061661 ACCCTTTCCAAGCCAGCTTTGGG + Intronic
1006877640 6:37312555-37312577 AAATTTTCCAGGCCATCTTCAGG + Intronic
1008163017 6:48101975-48101997 ACAGCTTCCCACCAAACTTCAGG + Intergenic
1008309314 6:49946418-49946440 TCAGTTTCCTCTCCAACTTCTGG + Intergenic
1013158787 6:107521524-107521546 ACAATTTCACAGTCAACTTCAGG + Intronic
1013667837 6:112366537-112366559 GCAGCTTCCAAGGCAACTTCCGG + Intergenic
1015571101 6:134622231-134622253 TCAGTTTCCAAACCTTCTTCAGG + Intergenic
1017711895 6:157177169-157177191 AGAATTTGCAAGCAAACTTCTGG + Intronic
1018341828 6:162858909-162858931 CTAGTTTCCATGCCTACTTCAGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1020002783 7:4765241-4765263 ACCGGTTCCAAGACAAGTTCCGG - Exonic
1022370140 7:29763251-29763273 TCAGTTTGCACCCCAACTTCAGG + Intergenic
1022388899 7:29926713-29926735 ACATTTCCCAAGCCAACTTATGG + Intronic
1024550678 7:50560320-50560342 TCAGTTTCCAAGCGAAATTCAGG - Intronic
1024771278 7:52726224-52726246 AGAGTTTCCATGTTAACTTCAGG + Intergenic
1024827449 7:53407986-53408008 AGATTTTCCCAGCTAACTTCTGG - Intergenic
1025005420 7:55350678-55350700 ACAGATGCCAAGGCAACATCTGG + Intergenic
1033592455 7:142822212-142822234 AAAGCTGCAAAGCCAACTTCTGG + Intergenic
1034743701 7:153502822-153502844 ACAGTGTACAAGCATACTTCAGG - Intergenic
1037807938 8:22068896-22068918 ACACTTTCCTGGCCAGCTTCTGG - Intronic
1038250431 8:25898989-25899011 AAAGTTTCCCAGGCAACTACTGG + Intronic
1039224993 8:35378605-35378627 ACAGATTCCAAGCCAAGATCAGG - Intronic
1042959963 8:74293110-74293132 ACAGGTTCCTACCCAAATTCTGG - Intronic
1050335256 9:4584234-4584256 ACAGCTTCCAAGCCAGGTGCAGG - Intronic
1050761734 9:9080667-9080689 ACAGTTTAGAATCCCACTTCTGG - Intronic
1051963619 9:22799307-22799329 ACAGCTTCCAAGCTGAATTCTGG + Intergenic
1055766071 9:79664802-79664824 ACAGTTTACAAGTGAACATCTGG - Intronic
1061521455 9:131120669-131120691 AAAGTCTCCAAGCCAAGTTCAGG + Exonic
1186247266 X:7627489-7627511 ACAGTTTCAAAGTCACCTTTTGG + Intergenic
1186319015 X:8403961-8403983 CCATTTTCTAAGCCATCTTCTGG + Intergenic
1186346939 X:8703286-8703308 ACAGTTGCCATGCCCACTTTTGG - Intronic
1186604040 X:11070416-11070438 ACACTTTCCAAACCAATGTCTGG - Intergenic
1193718194 X:84956870-84956892 ATAGTTTCCAAGTCGACTTTAGG + Intergenic
1196005780 X:110835687-110835709 ACAGTCTCCAAGCCCTCATCAGG + Intergenic
1200248270 X:154537785-154537807 ACACTTCCCAAGCCACCTTATGG + Intronic