ID: 1179214724

View in Genome Browser
Species Human (GRCh38)
Location 21:39357609-39357631
Sequence GTTCACCGAATCCCAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179214724_1179214726 7 Left 1179214724 21:39357609-39357631 CCATGCTTTGGGATTCGGTGAAC No data
Right 1179214726 21:39357639-39357661 AAGCATTTTCTGCATTTTGCTGG No data
1179214724_1179214727 13 Left 1179214724 21:39357609-39357631 CCATGCTTTGGGATTCGGTGAAC No data
Right 1179214727 21:39357645-39357667 TTTCTGCATTTTGCTGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179214724 Original CRISPR GTTCACCGAATCCCAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr