ID: 1179215742

View in Genome Browser
Species Human (GRCh38)
Location 21:39365953-39365975
Sequence ATAAGTTTAGTGGCCAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179215742_1179215745 28 Left 1179215742 21:39365953-39365975 CCAAACTTGGCCACTAAACTTAT No data
Right 1179215745 21:39366004-39366026 TCTCACTCTATCACCCAGGCTGG 0: 1300
1: 35039
2: 87842
3: 162487
4: 173416
1179215742_1179215744 24 Left 1179215742 21:39365953-39365975 CCAAACTTGGCCACTAAACTTAT No data
Right 1179215744 21:39366000-39366022 AGAGTCTCACTCTATCACCCAGG 0: 425
1: 12034
2: 50410
3: 108550
4: 163128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179215742 Original CRISPR ATAAGTTTAGTGGCCAAGTT TGG (reversed) Intergenic
No off target data available for this crispr