ID: 1179217692

View in Genome Browser
Species Human (GRCh38)
Location 21:39381265-39381287
Sequence ACGGAGGGCGCTCATTCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179217692_1179217701 7 Left 1179217692 21:39381265-39381287 CCCCGAGAATGAGCGCCCTCCGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1179217701 21:39381295-39381317 CAGCAGAAATGAGGAGCTGTTGG 0: 1
1: 0
2: 7
3: 42
4: 347
1179217692_1179217703 14 Left 1179217692 21:39381265-39381287 CCCCGAGAATGAGCGCCCTCCGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1179217703 21:39381302-39381324 AATGAGGAGCTGTTGGGCAAAGG 0: 1
1: 0
2: 33
3: 255
4: 1071
1179217692_1179217698 -2 Left 1179217692 21:39381265-39381287 CCCCGAGAATGAGCGCCCTCCGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1179217698 21:39381286-39381308 GTATGCCCACAGCAGAAATGAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1179217692_1179217702 8 Left 1179217692 21:39381265-39381287 CCCCGAGAATGAGCGCCCTCCGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1179217702 21:39381296-39381318 AGCAGAAATGAGGAGCTGTTGGG 0: 1
1: 0
2: 1
3: 31
4: 282
1179217692_1179217704 17 Left 1179217692 21:39381265-39381287 CCCCGAGAATGAGCGCCCTCCGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1179217704 21:39381305-39381327 GAGGAGCTGTTGGGCAAAGGCGG 0: 1
1: 0
2: 2
3: 25
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179217692 Original CRISPR ACGGAGGGCGCTCATTCTCG GGG (reversed) Intronic
902435985 1:16398312-16398334 ACCCAGGGCTCTCATTCTCTGGG - Intronic
917884019 1:179365913-179365935 ATGGAGGGCGCTAAACCTCGGGG + Exonic
1068515883 10:58024818-58024840 ATGGAGGAAGCTCATTCTGGTGG + Intergenic
1102423845 12:112825033-112825055 GCCGAGGAAGCTCATTCTCGGGG + Intronic
1108648043 13:52450170-52450192 ACGGCGAGCGCTCCTTCTCCCGG + Intronic
1113989820 13:114352681-114352703 ACGGAGGGCCCTCTTGCTCCCGG - Intergenic
1139420849 16:66848765-66848787 ACGGAGGGAGCTCCCTCTCTAGG + Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1169187902 20:3634253-3634275 ACGGTGGGAGCTGATTCTGGGGG + Intronic
1170886121 20:20341002-20341024 ACGGAAGGTGCCCATTCACGTGG + Intronic
1173498488 20:43535709-43535731 ACGCAGGGCCCTCATCCTTGGGG + Intronic
1175589084 20:60172963-60172985 AAGGTGGGAGCTCATTCTCATGG + Intergenic
1179217692 21:39381265-39381287 ACGGAGGGCGCTCATTCTCGGGG - Intronic
1179665460 21:42909010-42909032 ACCGAGGGCCCTCAGTGTCGAGG - Exonic
1182737303 22:32540030-32540052 AGGGATGGAGCTCATTCTTGAGG - Intronic
955122773 3:56077618-56077640 ACTAAGTGCGCTCATTCTTGAGG - Intronic
961531345 3:127542237-127542259 ACGCAGAGCCCTCAGTCTCGGGG - Intergenic
968603752 4:1521931-1521953 CAGGAGGGCGCTCTTCCTCGCGG - Intergenic
969848467 4:9937909-9937931 ACGGAGGCCGCTGATGCTTGAGG - Intronic
985257033 4:188080608-188080630 AGGGAGGGCGCTCTTTGTGGAGG + Intergenic
999873040 5:155772216-155772238 AAGGAGGGCGCTGTTTCTCAGGG + Intergenic
1031361791 7:120857264-120857286 TAGAAGGGCGCTCATTCTCTCGG - Intronic
1199058874 X:143329449-143329471 ACCCAGGGCGCTCATACTGGCGG + Intergenic